\
| Variant ID: vg0505530545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5530545 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TAGTAAAATAAATAATTGCATAAATTTTTTGATTAATTAAGACGAATGGTCAAAACATATATCAATGTCAACAATGTTATGCATTAAAAACCGGAGGGAG[C/T]
ACTTATTATCCTAAAATCATTCGTTACAAAGGACGATATGGGACCTAGGGGTCATTGTCTTGATACCAGTAAATATGAATGCATCCCTACATGGTCGTCT
AGACGACCATGTAGGGATGCATTCATATTTACTGGTATCAAGACAATGACCCCTAGGTCCCATATCGTCCTTTGTAACGAATGATTTTAGGATAATAAGT[G/A]
CTCCCTCCGGTTTTTAATGCATAACATTGTTGACATTGATATATGTTTTGACCATTCGTCTTAATTAATCAAAAAATTTATGCAATTATTTATTTTACTA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 8.10% | 3.22% | 0.00% | NA |
| All Indica | 2759 | 97.00% | 0.80% | 2.28% | 0.00% | NA |
| All Japonica | 1512 | 71.90% | 22.70% | 5.42% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.10% | 1.80% | 7.06% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 1.10% | 2.16% | 0.00% | NA |
| Temperate Japonica | 767 | 53.70% | 38.20% | 8.08% | 0.00% | NA |
| Tropical Japonica | 504 | 96.40% | 3.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.40% | 13.30% | 8.30% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 5.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 12.20% | 6.67% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505530545 | C -> T | LOC_Os05g09736.1 | upstream_gene_variant ; 4195.0bp to feature; MODIFIER | silent_mutation | Average:46.703; most accessible tissue: Zhenshan97 flower, score: 66.02 | N | N | N | N |
| vg0505530545 | C -> T | LOC_Os05g09740.1 | downstream_gene_variant ; 3983.0bp to feature; MODIFIER | silent_mutation | Average:46.703; most accessible tissue: Zhenshan97 flower, score: 66.02 | N | N | N | N |
| vg0505530545 | C -> T | LOC_Os05g09736-LOC_Os05g09740 | intergenic_region ; MODIFIER | silent_mutation | Average:46.703; most accessible tissue: Zhenshan97 flower, score: 66.02 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505530545 | NA | 1.04E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505530545 | NA | 6.80E-07 | mr1791 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505530545 | NA | 5.14E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505530545 | NA | 1.26E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505530545 | 2.11E-06 | NA | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505530545 | 1.54E-06 | 2.89E-10 | mr1588_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505530545 | NA | 2.16E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505530545 | NA | 7.45E-06 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |