Variant ID: vg0505521761 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 5521761 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCATAAATAAATCATGACATTACAGATGTATACTAGCATTAACGCATCATTAGATCTACACATGTAAACTAAGCAGTAAAATATGAACAGATCAAATAT[G/A]
CGCAACATGTCGAACACGTATCGAGGTGGTGGAAAGACCGGTTGCTCGGCAGGAACTACTCGAGGTTCCGAGCGTCGACGAAGGCGCGCAGCACGCGAGC
GCTCGCGTGCTGCGCGCCTTCGTCGACGCTCGGAACCTCGAGTAGTTCCTGCCGAGCAACCGGTCTTTCCACCACCTCGATACGTGTTCGACATGTTGCG[C/T]
ATATTTGATCTGTTCATATTTTACTGCTTAGTTTACATGTGTAGATCTAATGATGCGTTAATGCTAGTATACATCTGTAATGTCATGATTTATTTATGGA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
All Indica | 2759 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 62.30% | 37.70% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 13.50% | 86.50% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0505521761 | G -> A | LOC_Os05g09736.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.288; most accessible tissue: Minghui63 flag leaf, score: 59.912 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0505521761 | NA | 1.07E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505521761 | 2.43E-06 | 1.43E-08 | mr1243_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505521761 | NA | 2.46E-07 | mr1248_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505521761 | NA | 1.29E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505521761 | NA | 1.62E-08 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505521761 | NA | 8.31E-13 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505521761 | NA | 6.42E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |