Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0505514888:

Variant ID: vg0505514888 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5514888
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTTGATTTAAGTATATATCGATATAAGGATTATATATCGTTAATATCTACAGCCGATCGAGTAGATTTAGTTCTGTTTTATTTATTAATGCTTACCGAT[C/T]
GATGCATATATGACATCGGCTCAAAGATAAATGATATGTCATCGGCACCTAACCGATCGGCTATCATTTATAGATTTAATCATGGTTTCTTTGCCTTTAT

Reverse complement sequence

ATAAAGGCAAAGAAACCATGATTAAATCTATAAATGATAGCCGATCGGTTAGGTGCCGATGACATATCATTTATCTTTGAGCCGATGTCATATATGCATC[G/A]
ATCGGTAAGCATTAATAAATAAAACAGAACTAAATCTACTCGATCGGCTGTAGATATTAACGATATATAATCCTTATATCGATATATACTTAAATCAAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	6.70%	0.47%	0.11%	NA
All Indica	2759	96.20%	3.70%	0.04%	0.00%	NA
All Japonica	1512	84.50%	13.80%	1.32%	0.33%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	94.30%	5.70%	0.00%	0.00%	NA
Indica Intermediate	786	95.20%	4.70%	0.13%	0.00%	NA
Temperate Japonica	767	76.50%	20.60%	2.35%	0.52%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	79.70%	19.10%	0.83%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	4.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505514888	C -> T	LOC_Os05g09724.1	upstream_gene_variant ; 4598.0bp to feature; MODIFIER	silent_mutation	Average:31.041; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N
vg0505514888	C -> T	LOC_Os05g09728.1	upstream_gene_variant ; 1993.0bp to feature; MODIFIER	silent_mutation	Average:31.041; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N
vg0505514888	C -> T	LOC_Os05g09732.1	downstream_gene_variant ; 1206.0bp to feature; MODIFIER	silent_mutation	Average:31.041; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N
vg0505514888	C -> T	LOC_Os05g09728-LOC_Os05g09732	intergenic_region ; MODIFIER	silent_mutation	Average:31.041; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N
vg0505514888	C -> DEL	N	N	silent_mutation	Average:31.041; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505514888	NA	2.22E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505514888	NA	4.20E-08	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505514888	NA	6.59E-08	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505514888	5.23E-06	NA	mr1245	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505514888	3.14E-06	1.43E-08	mr1373	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505514888	3.94E-06	3.94E-06	mr1373	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505514888	NA	5.97E-08	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505514888	1.12E-08	2.72E-13	mr1697	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505514888	8.75E-12	6.89E-13	mr1697	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251