Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505471969:

Variant ID: vg0505471969 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5471969
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCTCCTCAGCATGTATCCTCTTCTCCTTTCCCCAGCGGCAGCGGCGGGTGACGTCGGCTCCTCCCCTTTGGATCTGGCCGGAGGTAGGTTGTAGCACT[C/T]
GGCGGTAGAGAGGAGGGGCGGCGCGGTGCCGGCGGCGGGTGGCGTCGGCTCTTCCCCACCGGTCCGGGGGTAGGTCGGCAGCGCCCAGTGGTAGGGAGGT

Reverse complement sequence

ACCTCCCTACCACTGGGCGCTGCCGACCTACCCCCGGACCGGTGGGGAAGAGCCGACGCCACCCGCCGCCGGCACCGCGCCGCCCCTCCTCTCTACCGCC[G/A]
AGTGCTACAACCTACCTCCGGCCAGATCCAAAGGGGAGGAGCCGACGTCACCCGCCGCTGCCGCTGGGGAAAGGAGAAGAGGATACATGCTGAGGAGAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.20%	14.80%	0.02%	0.00%	NA
All Indica	2759	95.90%	4.10%	0.00%	0.00%	NA
All Japonica	1512	62.50%	37.40%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	93.10%	6.90%	0.00%	0.00%	NA
Indica Intermediate	786	95.50%	4.50%	0.00%	0.00%	NA
Temperate Japonica	767	94.10%	5.90%	0.00%	0.00%	NA
Tropical Japonica	504	13.30%	86.50%	0.20%	0.00%	NA
Japonica Intermediate	241	64.70%	35.30%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	76.70%	23.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505471969	C -> T	LOC_Os05g09680.1	upstream_gene_variant ; 3325.0bp to feature; MODIFIER	silent_mutation	Average:73.149; most accessible tissue: Zhenshan97 young leaf, score: 88.759	N	N	N	N
vg0505471969	C -> T	LOC_Os05g09700.1	downstream_gene_variant ; 958.0bp to feature; MODIFIER	silent_mutation	Average:73.149; most accessible tissue: Zhenshan97 young leaf, score: 88.759	N	N	N	N
vg0505471969	C -> T	LOC_Os05g09704.1	downstream_gene_variant ; 720.0bp to feature; MODIFIER	silent_mutation	Average:73.149; most accessible tissue: Zhenshan97 young leaf, score: 88.759	N	N	N	N
vg0505471969	C -> T	LOC_Os05g09700-LOC_Os05g09704	intergenic_region ; MODIFIER	silent_mutation	Average:73.149; most accessible tissue: Zhenshan97 young leaf, score: 88.759	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505471969	NA	9.86E-06	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	1.77E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	1.14E-07	mr1559	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	8.82E-16	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	7.29E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	8.48E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	1.64E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	7.33E-06	mr1268_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	3.83E-06	mr1346_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	2.53E-06	2.80E-10	mr1363_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	3.04E-07	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	4.55E-08	mr1578_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	5.92E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	4.65E-30	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	6.29E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	2.54E-06	mr1780_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	1.36E-08	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	2.75E-13	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969	NA	3.76E-10	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251