\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505471969:

Variant ID: vg0505471969 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5471969
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCTCCTCAGCATGTATCCTCTTCTCCTTTCCCCAGCGGCAGCGGCGGGTGACGTCGGCTCCTCCCCTTTGGATCTGGCCGGAGGTAGGTTGTAGCACT[C/T]
GGCGGTAGAGAGGAGGGGCGGCGCGGTGCCGGCGGCGGGTGGCGTCGGCTCTTCCCCACCGGTCCGGGGGTAGGTCGGCAGCGCCCAGTGGTAGGGAGGT

Reverse complement sequence

ACCTCCCTACCACTGGGCGCTGCCGACCTACCCCCGGACCGGTGGGGAAGAGCCGACGCCACCCGCCGCCGGCACCGCGCCGCCCCTCCTCTCTACCGCC[G/A]
AGTGCTACAACCTACCTCCGGCCAGATCCAAAGGGGAGGAGCCGACGTCACCCGCCGCTGCCGCTGGGGAAAGGAGAAGAGGATACATGCTGAGGAGAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.20% 14.80% 0.02% 0.00% NA
All Indica  2759 95.90% 4.10% 0.00% 0.00% NA
All Japonica  1512 62.50% 37.40% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 93.10% 6.90% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.50% 0.00% 0.00% NA
Temperate Japonica  767 94.10% 5.90% 0.00% 0.00% NA
Tropical Japonica  504 13.30% 86.50% 0.20% 0.00% NA
Japonica Intermediate  241 64.70% 35.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505471969 C -> T LOC_Os05g09680.1 upstream_gene_variant ; 3325.0bp to feature; MODIFIER silent_mutation Average:73.149; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg0505471969 C -> T LOC_Os05g09700.1 downstream_gene_variant ; 958.0bp to feature; MODIFIER silent_mutation Average:73.149; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg0505471969 C -> T LOC_Os05g09704.1 downstream_gene_variant ; 720.0bp to feature; MODIFIER silent_mutation Average:73.149; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N
vg0505471969 C -> T LOC_Os05g09700-LOC_Os05g09704 intergenic_region ; MODIFIER silent_mutation Average:73.149; most accessible tissue: Zhenshan97 young leaf, score: 88.759 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505471969 NA 9.86E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 1.77E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 1.14E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 8.82E-16 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 7.29E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 8.48E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 1.64E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 7.33E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 3.83E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 2.53E-06 2.80E-10 mr1363_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 3.04E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 4.55E-08 mr1578_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 5.92E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 4.65E-30 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 6.29E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 2.54E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 1.36E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 2.75E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505471969 NA 3.76E-10 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251