\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505363587:

Variant ID: vg0505363587 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5363587
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.08, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CTGGACCGGCTACGGGAAGGGCAAGTTGGGAATGGGCAGGTTGGCGACGGTTGGTTGCAGTGAGGGAGGAAGCGAAGTCCGGCGAGATTGGCTGTGCCGC[C/T]
GCCAGGGACGACGGAAGGGGATCGGGAAGAGACAGATTACCGGGTCAGGGACTTGTACCGTCTCTATGAAAATTGACTAACCACGTAAAAATCCAATTCT

Reverse complement sequence

AGAATTGGATTTTTACGTGGTTAGTCAATTTTCATAGAGACGGTACAAGTCCCTGACCCGGTAATCTGTCTCTTCCCGATCCCCTTCCGTCGTCCCTGGC[G/A]
GCGGCACAGCCAATCTCGCCGGACTTCGCTTCCTCCCTCACTGCAACCAACCGTCGCCAACCTGCCCATTCCCAACTTGCCCTTCCCGTAGCCGGTCCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 39.30% 0.17% 1.80% NA
All Indica  2759 49.80% 49.90% 0.22% 0.07% NA
All Japonica  1512 85.40% 9.00% 0.07% 5.49% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 15.60% 84.20% 0.17% 0.00% NA
Indica II  465 82.80% 16.80% 0.43% 0.00% NA
Indica III  913 54.10% 45.70% 0.00% 0.22% NA
Indica Intermediate  786 51.00% 48.60% 0.38% 0.00% NA
Temperate Japonica  767 91.70% 8.00% 0.13% 0.26% NA
Tropical Japonica  504 74.60% 10.70% 0.00% 14.68% NA
Japonica Intermediate  241 88.40% 8.70% 0.00% 2.90% NA
VI/Aromatic  96 52.10% 46.90% 1.04% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505363587 C -> T LOC_Os05g09520.1 upstream_gene_variant ; 1535.0bp to feature; MODIFIER silent_mutation Average:70.6; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0505363587 C -> T LOC_Os05g09510-LOC_Os05g09520 intergenic_region ; MODIFIER silent_mutation Average:70.6; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0505363587 C -> DEL N N silent_mutation Average:70.6; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0505363587 C T -0.05 -0.01 -0.01 -0.04 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505363587 NA 5.47E-21 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505363587 1.38E-12 8.20E-20 Grain_thickness Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505363587 6.86E-07 NA Grain_weight Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505363587 3.57E-10 NA Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505363587 8.80E-21 1.50E-44 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505363587 NA 2.31E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505363587 NA 1.41E-24 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505363587 NA 2.32E-08 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505363587 NA 3.27E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505363587 NA 2.16E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505363587 NA 9.17E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505363587 NA 6.35E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505363587 NA 1.76E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505363587 NA 9.66E-07 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505363587 NA 9.90E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251