\
| Variant ID: vg0505359598 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5359598 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.79, A: 0.21, others allele: 0.00, population size: 92. )
GAACCCGTCACGTTCAAAGATGAACATGTACATTCATGCATTTGCAAAAAGGTGAACCTACCCATCGGACAAGGTGGGTCGATCGACCCAGCTATAGCCC[G/A]
TGTCACCCCCACACCCCACATAGACACCTCTAGCCCTCCTAGCAGCATATCCTGTCAACCCACCAGCCTGATAAGTCAACAACTGCCCATCATCAACGTT
AACGTTGATGATGGGCAGTTGTTGACTTATCAGGCTGGTGGGTTGACAGGATATGCTGCTAGGAGGGCTAGAGGTGTCTATGTGGGGTGTGGGGGTGACA[C/T]
GGGCTATAGCTGGGTCGATCGACCCACCTTGTCCGATGGGTAGGTTCACCTTTTTGCAAATGCATGAATGTACATGTTCATCTTTGAACGTGACGGGTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.80% | 33.30% | 0.13% | 1.78% | NA |
| All Indica | 2759 | 52.50% | 47.30% | 0.14% | 0.07% | NA |
| All Japonica | 1512 | 84.60% | 9.90% | 0.13% | 5.42% | NA |
| Aus | 269 | 77.70% | 22.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 17.00% | 82.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 86.20% | 13.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 58.80% | 41.00% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 52.20% | 47.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 91.80% | 8.00% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 71.80% | 13.30% | 0.00% | 14.88% | NA |
| Japonica Intermediate | 241 | 88.40% | 8.70% | 0.41% | 2.49% | NA |
| VI/Aromatic | 96 | 60.40% | 39.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 23.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505359598 | G -> DEL | N | N | silent_mutation | Average:65.977; most accessible tissue: Callus, score: 92.455 | N | N | N | N |
| vg0505359598 | G -> A | LOC_Os05g09510-LOC_Os05g09520 | intergenic_region ; MODIFIER | silent_mutation | Average:65.977; most accessible tissue: Callus, score: 92.455 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505359598 | 7.68E-08 | 1.00E-29 | Grain_length | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505359598 | 3.66E-10 | 7.34E-17 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505359598 | 1.10E-10 | NA | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505359598 | 1.16E-29 | 4.55E-54 | Grain_width | Ind_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505359598 | NA | 2.94E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 1.35E-08 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 2.66E-08 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 5.29E-10 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 3.71E-07 | mr1942 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 8.58E-06 | mr1159_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 1.37E-08 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 1.19E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 6.86E-09 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 9.31E-07 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505359598 | NA | 8.40E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |