Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0505322118:

Variant ID: vg0505322118 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5322118
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGGATCGTTGGTACTATGATATATGCGAGATTGAGGTAAAAGAGATGGAGGCGAGGATTTTTATACAGGTTCGAGCCCCTGAATTGTCAGGTTATAACC[C/T]
TACATCATGTTGGCCGAAGCCGGTATTGCTCTTATTCACCATAATCACACCAGTACAATATTTGGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTCT

Reverse complement sequence

AGACCGCCATGTCGACAACAGTTAGATAGGCTACCCCAAATATTGTACTGGTGTGATTATGGTGAATAAGAGCAATACCGGCTTCGGCCAACATGATGTA[G/A]
GGTTATAACCTGACAATTCAGGGGCTCGAACCTGTATAAAAATCCTCGCCTCCATCTCTTTTACCTCAATCTCGCATATATCATAGTACCAACGATCCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.90%	8.10%	0.00%	0.00%	NA
All Indica	2759	98.50%	1.50%	0.00%	0.00%	NA
All Japonica	1512	78.40%	21.60%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	97.10%	2.90%	0.00%	0.00%	NA
Temperate Japonica	767	94.70%	5.30%	0.00%	0.00%	NA
Tropical Japonica	504	55.20%	44.80%	0.00%	0.00%	NA
Japonica Intermediate	241	75.50%	24.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505322118	C -> T	LOC_Os05g09470.1	upstream_gene_variant ; 190.0bp to feature; MODIFIER	silent_mutation	Average:48.49; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N
vg0505322118	C -> T	LOC_Os05g09470-LOC_Os05g09480	intergenic_region ; MODIFIER	silent_mutation	Average:48.49; most accessible tissue: Minghui63 young leaf, score: 58.21	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505322118	2.75E-08	NA	Grain_thickness	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505322118	2.30E-08	1.49E-14	Grain_thickness	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505322118	4.59E-06	NA	Grain_width	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505322118	NA	4.45E-15	Grain_width	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505322118	NA	2.24E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505322118	NA	2.16E-07	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505322118	NA	2.85E-19	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505322118	NA	6.47E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505322118	NA	5.17E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251