Variant ID: vg0505322118 (JBrowse) | Variation Type: SNP |
Chromosome: chr05 | Position: 5322118 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GGGGATCGTTGGTACTATGATATATGCGAGATTGAGGTAAAAGAGATGGAGGCGAGGATTTTTATACAGGTTCGAGCCCCTGAATTGTCAGGTTATAACC[C/T]
TACATCATGTTGGCCGAAGCCGGTATTGCTCTTATTCACCATAATCACACCAGTACAATATTTGGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTCT
AGACCGCCATGTCGACAACAGTTAGATAGGCTACCCCAAATATTGTACTGGTGTGATTATGGTGAATAAGAGCAATACCGGCTTCGGCCAACATGATGTA[G/A]
GGTTATAACCTGACAATTCAGGGGCTCGAACCTGTATAAAAATCCTCGCCTCCATCTCTTTTACCTCAATCTCGCATATATCATAGTACCAACGATCCCC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 91.90% | 8.10% | 0.00% | 0.00% | NA |
All Indica | 2759 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0505322118 | C -> T | LOC_Os05g09470.1 | upstream_gene_variant ; 190.0bp to feature; MODIFIER | silent_mutation | Average:48.49; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
vg0505322118 | C -> T | LOC_Os05g09470-LOC_Os05g09480 | intergenic_region ; MODIFIER | silent_mutation | Average:48.49; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0505322118 | 2.75E-08 | NA | Grain_thickness | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0505322118 | 2.30E-08 | 1.49E-14 | Grain_thickness | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0505322118 | 4.59E-06 | NA | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0505322118 | NA | 4.45E-15 | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
vg0505322118 | NA | 2.24E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505322118 | NA | 2.16E-07 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505322118 | NA | 2.85E-19 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505322118 | NA | 6.47E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0505322118 | NA | 5.17E-09 | mr1916_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |