\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505304774:

Variant ID: vg0505304774 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5304774
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTGTTTTCTTCCAACCAGAAGCGAGAAGATGAGGTGTACATGTGAATATTAAATATCTAAATCTTCAATAGAGATAAACAAACAGCTAACCTAACAGCTA[T/G]
CCTATTATATTAGTGATGGCTATAGGTGACATGATATTAGAGTCGGCAGCTGGCTATATTATTATACGTTGGTGTCGGTTTCCTCCTCGAGCGCCGCGTC

Reverse complement sequence

GACGCGGCGCTCGAGGAGGAAACCGACACCAACGTATAATAATATAGCCAGCTGCCGACTCTAATATCATGTCACCTATAGCCATCACTAATATAATAGG[A/C]
TAGCTGTTAGGTTAGCTGTTTGTTTATCTCTATTGAAGATTTAGATATTTAATATTCACATGTACACCTCATCTTCTCGCTTCTGGTTGGAAGAAAACAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 14.70% 0.00% 0.00% NA
All Indica  2759 95.70% 4.30% 0.00% 0.00% NA
All Japonica  1512 79.90% 20.10% 0.00% 0.00% NA
Aus  269 11.50% 88.50% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 98.00% 2.00% 0.00% 0.00% NA
Indica Intermediate  786 91.00% 9.00% 0.00% 0.00% NA
Temperate Japonica  767 94.50% 5.50% 0.00% 0.00% NA
Tropical Japonica  504 60.30% 39.70% 0.00% 0.00% NA
Japonica Intermediate  241 74.30% 25.70% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505304774 T -> G LOC_Os05g09460.1 upstream_gene_variant ; 4907.0bp to feature; MODIFIER silent_mutation Average:93.934; most accessible tissue: Minghui63 root, score: 99.485 N N N N
vg0505304774 T -> G LOC_Os05g09450.1 downstream_gene_variant ; 1438.0bp to feature; MODIFIER silent_mutation Average:93.934; most accessible tissue: Minghui63 root, score: 99.485 N N N N
vg0505304774 T -> G LOC_Os05g09450-LOC_Os05g09460 intergenic_region ; MODIFIER silent_mutation Average:93.934; most accessible tissue: Minghui63 root, score: 99.485 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0505304774 T G -0.02 -0.04 -0.03 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505304774 NA 7.33E-13 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505304774 2.03E-06 8.81E-06 mr1113 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505304774 NA 1.81E-10 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505304774 NA 9.82E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251