\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505293413:

Variant ID: vg0505293413 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 5293413
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGAGGTGAGAGGATGACATGTGGACCCCACATGTCATCCTTTATGTGAATGATAAATGGGCCCTATATATTTTTTAATTCTAATATCACGCAAGCACCA[T/C]
GTGTAAGGAAGACCCTGTCAACACCACCACGTAGGTGCCACGTCAGCAAAACCGCCGAGGGAGACAAATTACACCGGTTTTAAGAGTTAGGGGGTTCACG

Reverse complement sequence

CGTGAACCCCCTAACTCTTAAAACCGGTGTAATTTGTCTCCCTCGGCGGTTTTGCTGACGTGGCACCTACGTGGTGGTGTTGACAGGGTCTTCCTTACAC[A/G]
TGGTGCTTGCGTGATATTAGAATTAAAAAATATATAGGGCCCATTTATCATTCACATAAAGGATGACATGTGGGGTCCACATGTCATCCTCTCACCTCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 14.00% 0.00% 0.00% NA
All Indica  2759 97.50% 2.50% 0.00% 0.00% NA
All Japonica  1512 78.80% 21.20% 0.00% 0.00% NA
Aus  269 9.70% 90.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.30% 4.70% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 5.00% 0.00% 0.00% NA
Temperate Japonica  767 94.70% 5.30% 0.00% 0.00% NA
Tropical Japonica  504 59.10% 40.90% 0.00% 0.00% NA
Japonica Intermediate  241 69.30% 30.70% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0505293413 T -> C LOC_Os05g09420.1 upstream_gene_variant ; 4506.0bp to feature; MODIFIER silent_mutation Average:94.676; most accessible tissue: Minghui63 young leaf, score: 97.824 N N N N
vg0505293413 T -> C LOC_Os05g09430.1 upstream_gene_variant ; 81.0bp to feature; MODIFIER silent_mutation Average:94.676; most accessible tissue: Minghui63 young leaf, score: 97.824 N N N N
vg0505293413 T -> C LOC_Os05g09440.1 downstream_gene_variant ; 142.0bp to feature; MODIFIER silent_mutation Average:94.676; most accessible tissue: Minghui63 young leaf, score: 97.824 N N N N
vg0505293413 T -> C LOC_Os05g09430-LOC_Os05g09440 intergenic_region ; MODIFIER silent_mutation Average:94.676; most accessible tissue: Minghui63 young leaf, score: 97.824 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0505293413 T C 0.02 0.03 0.04 0.04 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0505293413 1.34E-08 NA Grain_width All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505293413 9.71E-09 3.67E-14 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0505293413 NA 3.09E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505293413 NA 1.84E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505293413 NA 7.74E-07 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505293413 NA 1.05E-08 mr1563 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505293413 NA 5.22E-11 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505293413 NA 1.93E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505293413 NA 4.50E-08 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505293413 NA 4.98E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251