Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0505202290:

Variant ID: vg0505202290 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 5202290
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAATTATATATGATTATTAGAATTTTTATTAATTTTAAATCATGCATGTGGTATTTACATATATTAATTAGAATTTTTAACAATTTAATATCATGCATAT[G/A]
CTAATTATATATGATTATTAAAAATTTTAACAATTTTAAATCATTCATGCGCTAATTATATATTATCCACTTAGTTTACTACAGACAACAATAATTTTTC

Reverse complement sequence

GAAAAATTATTGTTGTCTGTAGTAAACTAAGTGGATAATATATAATTAGCGCATGAATGATTTAAAATTGTTAAAATTTTTAATAATCATATATAATTAG[C/T]
ATATGCATGATATTAAATTGTTAAAAATTCTAATTAATATATGTAAATACCACATGCATGATTTAAAATTAATAAAAATTCTAATAATCATATATAATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.50%	0.30%	3.30%	3.89%	NA
All Indica	2759	99.10%	0.00%	0.69%	0.25%	NA
All Japonica	1512	86.30%	1.00%	4.37%	8.33%	NA
Aus	269	59.90%	0.00%	22.68%	17.47%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	98.30%	0.00%	1.08%	0.65%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	98.10%	0.00%	1.53%	0.38%	NA
Temperate Japonica	767	90.70%	1.70%	4.04%	3.52%	NA
Tropical Japonica	504	82.70%	0.00%	4.56%	12.70%	NA
Japonica Intermediate	241	79.70%	0.80%	4.98%	14.52%	NA
VI/Aromatic	96	92.70%	0.00%	5.21%	2.08%	NA
Intermediate	90	92.20%	0.00%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0505202290	G -> DEL	N	N	silent_mutation	Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N
vg0505202290	G -> A	LOC_Os05g09320.1	upstream_gene_variant ; 1796.0bp to feature; MODIFIER	silent_mutation	Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N
vg0505202290	G -> A	LOC_Os05g09300.1	downstream_gene_variant ; 427.0bp to feature; MODIFIER	silent_mutation	Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N
vg0505202290	G -> A	LOC_Os05g09310.1	downstream_gene_variant ; 767.0bp to feature; MODIFIER	silent_mutation	Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N
vg0505202290	G -> A	LOC_Os05g09300-LOC_Os05g09310	intergenic_region ; MODIFIER	silent_mutation	Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0505202290	NA	1.09E-07	mr1071	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	2.19E-07	mr1080	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	5.14E-06	1.40E-08	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	4.89E-08	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	2.32E-08	mr1203	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	1.70E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	5.92E-06	1.55E-09	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	9.74E-08	mr1618	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	2.64E-06	mr1619	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	8.39E-09	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	7.82E-07	mr1962	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	2.96E-07	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	6.56E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	1.57E-07	mr1613_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	3.71E-08	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0505202290	NA	4.71E-07	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251