| Variant ID: vg0505202290 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5202290 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAATTATATATGATTATTAGAATTTTTATTAATTTTAAATCATGCATGTGGTATTTACATATATTAATTAGAATTTTTAACAATTTAATATCATGCATAT[G/A]
CTAATTATATATGATTATTAAAAATTTTAACAATTTTAAATCATTCATGCGCTAATTATATATTATCCACTTAGTTTACTACAGACAACAATAATTTTTC
GAAAAATTATTGTTGTCTGTAGTAAACTAAGTGGATAATATATAATTAGCGCATGAATGATTTAAAATTGTTAAAATTTTTAATAATCATATATAATTAG[C/T]
ATATGCATGATATTAAATTGTTAAAAATTCTAATTAATATATGTAAATACCACATGCATGATTTAAAATTAATAAAAATTCTAATAATCATATATAATTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.50% | 0.30% | 3.30% | 3.89% | NA |
| All Indica | 2759 | 99.10% | 0.00% | 0.69% | 0.25% | NA |
| All Japonica | 1512 | 86.30% | 1.00% | 4.37% | 8.33% | NA |
| Aus | 269 | 59.90% | 0.00% | 22.68% | 17.47% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.30% | 0.00% | 1.08% | 0.65% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 98.10% | 0.00% | 1.53% | 0.38% | NA |
| Temperate Japonica | 767 | 90.70% | 1.70% | 4.04% | 3.52% | NA |
| Tropical Japonica | 504 | 82.70% | 0.00% | 4.56% | 12.70% | NA |
| Japonica Intermediate | 241 | 79.70% | 0.80% | 4.98% | 14.52% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 5.21% | 2.08% | NA |
| Intermediate | 90 | 92.20% | 0.00% | 5.56% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505202290 | G -> DEL | N | N | silent_mutation | Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335 | N | N | N | N |
| vg0505202290 | G -> A | LOC_Os05g09320.1 | upstream_gene_variant ; 1796.0bp to feature; MODIFIER | silent_mutation | Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335 | N | N | N | N |
| vg0505202290 | G -> A | LOC_Os05g09300.1 | downstream_gene_variant ; 427.0bp to feature; MODIFIER | silent_mutation | Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335 | N | N | N | N |
| vg0505202290 | G -> A | LOC_Os05g09310.1 | downstream_gene_variant ; 767.0bp to feature; MODIFIER | silent_mutation | Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335 | N | N | N | N |
| vg0505202290 | G -> A | LOC_Os05g09300-LOC_Os05g09310 | intergenic_region ; MODIFIER | silent_mutation | Average:25.065; most accessible tissue: Minghui63 flag leaf, score: 34.335 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505202290 | NA | 1.09E-07 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505202290 | NA | 2.19E-07 | mr1080 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505202290 | 5.14E-06 | 1.40E-08 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505202290 | NA | 4.89E-08 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505202290 | NA | 2.32E-08 | mr1203 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505202290 | NA | 1.70E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505202290 | 5.92E-06 | 1.55E-09 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505202290 | NA | 9.74E-08 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505202290 | NA | 2.64E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505202290 | NA | 8.39E-09 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/