| Variant ID: vg0505166048 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5166048 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GAAAAGAAAATCAAATATTAAGCAAATAATTGTGCTAAGTATCTTTATTTCTATCTCTCTTTACTATTATAAACATTGAAGATGTTTTTATCGGTATTTT[A/G]
GTACCTCATTCGTATTTAAGTCGGTTTTTAAGTTCGTTCGTTTTTAGAAATACAGATCCGTGTTTGAGTCAGTTTTTAAGTTATTTCGCTTTTAGAAATA
TATTTCTAAAAGCGAAATAACTTAAAAACTGACTCAAACACGGATCTGTATTTCTAAAAACGAACGAACTTAAAAACCGACTTAAATACGAATGAGGTAC[T/C]
AAAATACCGATAAAAACATCTTCAATGTTTATAATAGTAAAGAGAGATAGAAATAAAGATACTTAGCACAATTATTTGCTTAATATTTGATTTTCTTTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.10% | 7.60% | 3.96% | 6.39% | NA |
| All Indica | 2759 | 97.40% | 0.70% | 1.23% | 0.69% | NA |
| All Japonica | 1512 | 68.90% | 16.00% | 9.06% | 6.02% | NA |
| Aus | 269 | 30.90% | 0.00% | 1.12% | 68.03% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 0.20% | 2.58% | 0.86% | NA |
| Indica III | 913 | 98.70% | 0.80% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 1.40% | 2.16% | 1.91% | NA |
| Temperate Japonica | 767 | 77.80% | 18.00% | 1.43% | 2.74% | NA |
| Tropical Japonica | 504 | 55.20% | 15.50% | 20.44% | 8.93% | NA |
| Japonica Intermediate | 241 | 69.30% | 10.80% | 9.54% | 10.37% | NA |
| VI/Aromatic | 96 | 7.30% | 87.50% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 66.70% | 14.40% | 13.33% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505166048 | A -> DEL | N | N | silent_mutation | Average:42.439; most accessible tissue: Minghui63 flower, score: 57.706 | N | N | N | N |
| vg0505166048 | A -> G | LOC_Os05g09250.1 | upstream_gene_variant ; 4658.0bp to feature; MODIFIER | silent_mutation | Average:42.439; most accessible tissue: Minghui63 flower, score: 57.706 | N | N | N | N |
| vg0505166048 | A -> G | LOC_Os05g09240.1 | downstream_gene_variant ; 3676.0bp to feature; MODIFIER | silent_mutation | Average:42.439; most accessible tissue: Minghui63 flower, score: 57.706 | N | N | N | N |
| vg0505166048 | A -> G | LOC_Os05g09240-LOC_Os05g09250 | intergenic_region ; MODIFIER | silent_mutation | Average:42.439; most accessible tissue: Minghui63 flower, score: 57.706 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505166048 | 2.48E-06 | NA | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505166048 | 1.01E-07 | NA | Grain_width | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505166048 | 1.75E-06 | NA | Grain_width | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0505166048 | NA | 6.90E-07 | mr1206 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |