| Variant ID: vg0505162615 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5162615 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGAATTTTGAACAAGTTTTGTTAAATTTGAAAAACTACTTTGGCTAAATTCACAAAAAAAAAACATTCCTGAAAATTTCGGCGAAATAGTTTCATATAGG[G/A]
CGGGCCTAAATTCATGACTTTTTGAAAGTATTATTCCGGAATTTTGAACCTGGTAACAACTTCAGAGTTTGTGATAGTACTCATTTAAAGTTAACTTAGA
TCTAAGTTAACTTTAAATGAGTACTATCACAAACTCTGAAGTTGTTACCAGGTTCAAAATTCCGGAATAATACTTTCAAAAAGTCATGAATTTAGGCCCG[C/T]
CCTATATGAAACTATTTCGCCGAAATTTTCAGGAATGTTTTTTTTTTGTGAATTTAGCCAAAGTAGTTTTTCAAATTTAACAAAACTTGTTCAAAATTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.70% | 7.70% | 0.30% | 4.30% | NA |
| All Indica | 2759 | 97.00% | 2.20% | 0.04% | 0.69% | NA |
| All Japonica | 1512 | 86.20% | 13.50% | 0.26% | 0.07% | NA |
| Aus | 269 | 32.00% | 0.00% | 3.35% | 64.68% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.40% | 0.00% | 0.00% | 0.65% | NA |
| Indica III | 913 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 4.50% | 0.13% | 2.04% | NA |
| Temperate Japonica | 767 | 82.80% | 16.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 87.90% | 11.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.80% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 6.20% | 88.50% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 82.20% | 13.30% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505162615 | G -> DEL | N | N | silent_mutation | Average:48.867; most accessible tissue: Minghui63 flower, score: 65.501 | N | N | N | N |
| vg0505162615 | G -> A | LOC_Os05g09230.1 | upstream_gene_variant ; 1768.0bp to feature; MODIFIER | silent_mutation | Average:48.867; most accessible tissue: Minghui63 flower, score: 65.501 | N | N | N | N |
| vg0505162615 | G -> A | LOC_Os05g09240.1 | downstream_gene_variant ; 243.0bp to feature; MODIFIER | silent_mutation | Average:48.867; most accessible tissue: Minghui63 flower, score: 65.501 | N | N | N | N |
| vg0505162615 | G -> A | LOC_Os05g09240-LOC_Os05g09250 | intergenic_region ; MODIFIER | silent_mutation | Average:48.867; most accessible tissue: Minghui63 flower, score: 65.501 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505162615 | NA | 9.73E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505162615 | NA | 2.26E-10 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505162615 | NA | 2.15E-06 | mr1167_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505162615 | NA | 2.52E-06 | mr1274_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505162615 | NA | 6.31E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505162615 | 7.40E-08 | 7.40E-08 | mr1587_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505162615 | NA | 5.66E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |