\
| Variant ID: vg0505080082 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5080082 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGTGGCATGGCAAACAAAGTGTGGCCAACAATTTGTTGGCCACGAGTGTGGTAATGTTTAGCTAGAAAATGAGTATATGACATGTAGGCCCATGAAACAA[G/A]
AAAGTGTGGCTTGCCACAACTGAAACAAGCAACCAAACGCTAAGCTAACAATCTGTGGCATGCCTAACATGTGGTGTGGCAATGTGTGGCACCAAACCAA
TTGGTTTGGTGCCACACATTGCCACACCACATGTTAGGCATGCCACAGATTGTTAGCTTAGCGTTTGGTTGCTTGTTTCAGTTGTGGCAAGCCACACTTT[C/T]
TTGTTTCATGGGCCTACATGTCATATACTCATTTTCTAGCTAAACATTACCACACTCGTGGCCAACAAATTGTTGGCCACACTTTGTTTGCCATGCCACA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.00% | 6.50% | 0.38% | 5.14% | NA |
| All Indica | 2759 | 98.60% | 0.50% | 0.07% | 0.83% | NA |
| All Japonica | 1512 | 86.20% | 13.50% | 0.13% | 0.13% | NA |
| Aus | 269 | 17.80% | 0.00% | 4.83% | 77.32% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.22% | 0.86% | NA |
| Indica III | 913 | 99.00% | 0.70% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 97.10% | 0.80% | 0.13% | 2.04% | NA |
| Temperate Japonica | 767 | 82.50% | 17.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.40% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 6.20% | 86.50% | 1.04% | 6.25% | NA |
| Intermediate | 90 | 87.80% | 7.80% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505080082 | G -> DEL | N | N | silent_mutation | Average:71.279; most accessible tissue: Minghui63 panicle, score: 88.595 | N | N | N | N |
| vg0505080082 | G -> A | LOC_Os05g09120.1 | downstream_gene_variant ; 3197.0bp to feature; MODIFIER | silent_mutation | Average:71.279; most accessible tissue: Minghui63 panicle, score: 88.595 | N | N | N | N |
| vg0505080082 | G -> A | LOC_Os05g09120-LOC_Os05g09130 | intergenic_region ; MODIFIER | silent_mutation | Average:71.279; most accessible tissue: Minghui63 panicle, score: 88.595 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505080082 | NA | 3.59E-06 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505080082 | NA | 2.05E-07 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505080082 | 3.87E-06 | 3.86E-06 | mr1885 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505080082 | NA | 2.83E-06 | mr1913 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505080082 | NA | 3.60E-10 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505080082 | NA | 9.08E-16 | mr1842_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |