\
| Variant ID: vg0505001004 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 5001004 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGATTATGGCTGCCTGTTTCTTTGGAAGGAATGTGACGAGGGTTTATTTGTAAAACAGTTTTTACTGTACGTGTAGATCCTAAAATTATATGCACCACAT[G/T]
ATCTCTTCTTGTGCTTATTCTTTATCTTTTTTCTTTTCTTTTCTTTCTTTCAATAACTTCATGCATATTCGAAAGTCTTGAATTTTACCATCCATCTAGC
GCTAGATGGATGGTAAAATTCAAGACTTTCGAATATGCATGAAGTTATTGAAAGAAAGAAAAGAAAAGAAAAAAGATAAAGAATAAGCACAAGAAGAGAT[C/A]
ATGTGGTGCATATAATTTTAGGATCTACACGTACAGTAAAAACTGTTTTACAAATAAACCCTCGTCACATTCCTTCCAAAGAAACAGGCAGCCATAATCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.50% | 13.20% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.80% | 11.40% | 0.79% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 86.70% | 11.90% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 89.30% | 10.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0505001004 | G -> T | LOC_Os05g09020.1 | upstream_gene_variant ; 1378.0bp to feature; MODIFIER | silent_mutation | Average:31.96; most accessible tissue: Callus, score: 61.075 | N | N | N | N |
| vg0505001004 | G -> T | LOC_Os05g09020.2 | upstream_gene_variant ; 1375.0bp to feature; MODIFIER | silent_mutation | Average:31.96; most accessible tissue: Callus, score: 61.075 | N | N | N | N |
| vg0505001004 | G -> T | LOC_Os05g09020-LOC_Os05g09030 | intergenic_region ; MODIFIER | silent_mutation | Average:31.96; most accessible tissue: Callus, score: 61.075 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0505001004 | NA | 4.71E-07 | mr1057 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 7.74E-08 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 1.23E-08 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 8.69E-08 | mr1126_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 7.60E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 1.64E-06 | mr1456_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 8.79E-08 | mr1465_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 1.51E-06 | mr1577_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 4.33E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | 6.81E-07 | 6.81E-07 | mr1587_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 2.30E-06 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0505001004 | NA | 2.23E-06 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |