| Variant ID: vg0504952991 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4952991 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAGCCAGAAGCTGGGTTTCAGAGCTTTTCCAGATTCTCAGAAGCTGGCTACCAAACAGCTGCTTTTCAGAATCTAAAGCTCCCCCAAACAGACCTAAAA[A/T]
CTACCTACAGCCGATAGATGACTATGGTCATGTTTCTTCCTTCTCTTTTACTTTTTGATTCACGTGATCCTACTTCTAGATTTTGGTTTTGTGAAGCTAA
TTAGCTTCACAAAACCAAAATCTAGAAGTAGGATCACGTGAATCAAAAAGTAAAAGAGAAGGAAGAAACATGACCATAGTCATCTATCGGCTGTAGGTAG[T/A]
TTTTAGGTCTGTTTGGGGGAGCTTTAGATTCTGAAAAGCAGCTGTTTGGTAGCCAGCTTCTGAGAATCTGGAAAAGCTCTGAAACCCAGCTTCTGGCTTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.60% | 3.70% | 0.78% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 1.10% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 89.60% | 9.20% | 1.19% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 0.00% | 1.51% | 0.00% | NA |
| Indica II | 465 | 95.30% | 4.30% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.30% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 98.60% | 0.70% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 87.50% | 12.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.60% | 29.90% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504952991 | A -> T | LOC_Os05g08950.1 | upstream_gene_variant ; 1117.0bp to feature; MODIFIER | silent_mutation | Average:46.528; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0504952991 | A -> T | LOC_Os05g08950-LOC_Os05g08960 | intergenic_region ; MODIFIER | silent_mutation | Average:46.528; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504952991 | NA | 3.62E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504952991 | NA | 5.12E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504952991 | NA | 4.24E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504952991 | 7.29E-06 | 7.14E-09 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504952991 | 2.29E-06 | 1.06E-09 | mr1118 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504952991 | 3.92E-07 | 1.42E-09 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504952991 | NA | 4.69E-07 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504952991 | 2.10E-07 | 7.79E-10 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504952991 | NA | 1.03E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504952991 | NA | 6.35E-07 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/