Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504924350:

Variant ID: vg0504924350 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4924350
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTATGGTTTCAGAAAACTAAAATTTTAAAAGCGGTCTCATATCCAAAACTTCCTTTCTTTCATAGACACTAAACTATGCATTCAGAGGTGACCACTAAAT[G/C]
AACTAACAGAAGATGGATCAGCACCAAGTTTATAGCAGCACCTTCATTGTACACACAAAAATAAAACCAGTACGTTGCATACCAGAACTTGACAAAATAT

Reverse complement sequence

ATATTTTGTCAAGTTCTGGTATGCAACGTACTGGTTTTATTTTTGTGTGTACAATGAAGGTGCTGCTATAAACTTGGTGCTGATCCATCTTCTGTTAGTT[C/G]
ATTTAGTGGTCACCTCTGAATGCATAGTTTAGTGTCTATGAAAGAAAGGAAGTTTTGGATATGAGACCGCTTTTAAAATTTTAGTTTTCTGAAACCATAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	78.40%	0.80%	0.80%	20.00%	NA
All Indica	2759	72.30%	1.40%	0.98%	25.23%	NA
All Japonica	1512	97.00%	0.00%	0.13%	2.84%	NA
Aus	269	25.30%	0.00%	3.35%	71.38%	NA
Indica I	595	96.30%	0.00%	1.01%	2.69%	NA
Indica II	465	39.10%	8.00%	1.94%	50.97%	NA
Indica III	913	73.60%	0.00%	0.33%	26.07%	NA
Indica Intermediate	786	72.40%	0.40%	1.15%	26.08%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	92.50%	0.00%	0.40%	7.14%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	91.10%	0.00%	0.00%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504924350	G -> DEL	N	N	silent_mutation	Average:26.981; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg0504924350	G -> C	LOC_Os05g08900.1	upstream_gene_variant ; 862.0bp to feature; MODIFIER	silent_mutation	Average:26.981; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg0504924350	G -> C	LOC_Os05g08890.1	downstream_gene_variant ; 3496.0bp to feature; MODIFIER	silent_mutation	Average:26.981; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N
vg0504924350	G -> C	LOC_Os05g08890-LOC_Os05g08900	intergenic_region ; MODIFIER	silent_mutation	Average:26.981; most accessible tissue: Zhenshan97 flag leaf, score: 63.101	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504924350	NA	3.93E-07	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504924350	NA	3.17E-06	mr1337	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504924350	3.12E-06	3.12E-06	mr1572	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251