\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504913720:

Variant ID: vg0504913720 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4913720
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


ATAACTACATATTCTCAGAAGCTGTAGACTATTTGAGACAGCTTCTAGCAGAAGCAGTTTTTGGGAAAAGCTGCACCTCCCAAACAGAGCGTATATATAT[A/G]
AACTCTGATCAGCTAATCGAGTCATTCATCCAGAGCAAACCGTTCACCAACACGAAGCCGGAGCTCAGCTGGTGCTCGATCCAAGGCCAAGGAATATTAA

Reverse complement sequence

TTAATATTCCTTGGCCTTGGATCGAGCACCAGCTGAGCTCCGGCTTCGTGTTGGTGAACGGTTTGCTCTGGATGAATGACTCGATTAGCTGATCAGAGTT[T/C]
ATATATATACGCTCTGTTTGGGAGGTGCAGCTTTTCCCAAAAACTGCTTCTGCTAGAAGCTGTCTCAAATAGTCTACAGCTTCTGAGAATATGTAGTTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 4.10% 2.77% 3.49% NA
All Indica  2759 94.80% 1.20% 3.04% 0.94% NA
All Japonica  1512 93.70% 0.10% 1.06% 5.16% NA
Aus  269 13.40% 55.00% 10.04% 21.56% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 92.90% 1.70% 3.66% 1.72% NA
Indica III  913 94.30% 0.90% 3.83% 0.99% NA
Indica Intermediate  786 92.90% 2.20% 3.82% 1.15% NA
Temperate Japonica  767 97.80% 0.00% 0.00% 2.22% NA
Tropical Japonica  504 88.90% 0.00% 0.40% 10.71% NA
Japonica Intermediate  241 90.50% 0.80% 5.81% 2.90% NA
VI/Aromatic  96 91.70% 6.20% 0.00% 2.08% NA
Intermediate  90 91.10% 3.30% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504913720 A -> DEL N N silent_mutation Average:92.594; most accessible tissue: Minghui63 young leaf, score: 98.213 N N N N
vg0504913720 A -> G LOC_Os05g08890.1 upstream_gene_variant ; 129.0bp to feature; MODIFIER silent_mutation Average:92.594; most accessible tissue: Minghui63 young leaf, score: 98.213 N N N N
vg0504913720 A -> G LOC_Os05g08880.1 downstream_gene_variant ; 4089.0bp to feature; MODIFIER silent_mutation Average:92.594; most accessible tissue: Minghui63 young leaf, score: 98.213 N N N N
vg0504913720 A -> G LOC_Os05g08880-LOC_Os05g08890 intergenic_region ; MODIFIER silent_mutation Average:92.594; most accessible tissue: Minghui63 young leaf, score: 98.213 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0504913720 A G -0.05 0.03 0.02 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504913720 NA 6.07E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 9.81E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 7.66E-22 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 9.47E-19 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 5.64E-07 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 4.80E-19 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 4.83E-06 mr1117 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 4.94E-15 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 2.45E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 2.11E-21 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 9.70E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 1.08E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 3.41E-21 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 1.61E-06 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 1.55E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 9.45E-06 mr1351 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 4.45E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 8.86E-07 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 3.54E-06 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 4.06E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 2.33E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 3.04E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 2.97E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 3.72E-21 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 3.14E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 1.01E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 4.00E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 1.50E-08 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 1.58E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504913720 NA 6.48E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251