Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504904086:

Variant ID: vg0504904086 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4904086
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:

CATGCTTCAAGTGGCTAGGAGGGCATCCTCCATTTTAAGGAGGTCCCCCTCTCCTAAAATAAGCAAGGTGGTACTAAACTCCACATGCATGCCATCCCAT[G/A]
AGGTGGGCTTTTGTGATTTTCCAAAGAATTAATCTTCGAGTGGGCCTTAGCCCATCCATTAATTCCAACAGAAGGTGGCAGCGGGGGATTGCGACGGCAA

Reverse complement sequence

TTGCCGTCGCAATCCCCCGCTGCCACCTTCTGTTGGAATTAATGGATGGGCTAAGGCCCACTCGAAGATTAATTCTTTGGAAAATCACAAAAGCCCACCT[C/T]
ATGGGATGGCATGCATGTGGAGTTTAGTACCACCTTGCTTATTTTAGGAGAGGGGGACCTCCTTAAAATGGAGGATGCCCTCCTAGCCACTTGAAGCATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.80%	0.10%	2.60%	24.44%	NA
All Indica	2759	64.30%	0.20%	2.36%	33.09%	NA
All Japonica	1512	97.10%	0.00%	2.12%	0.79%	NA
Aus	269	12.60%	0.00%	7.81%	79.55%	NA
Indica I	595	91.30%	0.20%	1.85%	6.72%	NA
Indica II	465	35.70%	0.40%	1.29%	62.58%	NA
Indica III	913	61.90%	0.10%	2.52%	35.49%	NA
Indica Intermediate	786	63.70%	0.30%	3.18%	32.82%	NA
Temperate Japonica	767	97.50%	0.00%	1.83%	0.65%	NA
Tropical Japonica	504	96.00%	0.00%	2.98%	0.99%	NA
Japonica Intermediate	241	97.90%	0.00%	1.24%	0.83%	NA
VI/Aromatic	96	91.70%	0.00%	2.08%	6.25%	NA
Intermediate	90	85.60%	0.00%	3.33%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504904086	G -> DEL	N	N	silent_mutation	Average:57.892; most accessible tissue: Minghui63 young leaf, score: 89.109	N	N	N	N
vg0504904086	G -> A	LOC_Os05g08870.1	upstream_gene_variant ; 1006.0bp to feature; MODIFIER	silent_mutation	Average:57.892; most accessible tissue: Minghui63 young leaf, score: 89.109	N	N	N	N
vg0504904086	G -> A	LOC_Os05g08880.1	upstream_gene_variant ; 166.0bp to feature; MODIFIER	silent_mutation	Average:57.892; most accessible tissue: Minghui63 young leaf, score: 89.109	N	N	N	N
vg0504904086	G -> A	LOC_Os05g08870-LOC_Os05g08880	intergenic_region ; MODIFIER	silent_mutation	Average:57.892; most accessible tissue: Minghui63 young leaf, score: 89.109	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504904086	7.31E-06	2.74E-06	mr1792	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504904086	7.82E-06	NA	mr1717_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504904086	2.25E-06	2.25E-06	mr1770_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504904086	4.69E-06	5.97E-06	mr1910_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504904086	4.89E-07	7.81E-07	mr1946_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504904086	4.89E-07	7.81E-07	mr1948_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251