| Variant ID: vg0504875404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4875404 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TGCCATTATAATTTTGCAAAATTTGAGATATGCCATCCTGACCCACATGTCATTAACTCATGTGGGTCCTACATGTCATTGAGATACCGATGACATATCT[C/T]
AAACTTTGAAAAATTATAATGGTATGGTTCCAATTTACCCATAATCTTATGTATTTGTTTTCGATCTTACTCAACAATCTCGTCTTGACTTTAACTAACG
CGTTAGTTAAAGTCAAGACGAGATTGTTGAGTAAGATCGAAAACAAATACATAAGATTATGGGTAAATTGGAACCATACCATTATAATTTTTCAAAGTTT[G/A]
AGATATGTCATCGGTATCTCAATGACATGTAGGACCCACATGAGTTAATGACATGTGGGTCAGGATGGCATATCTCAAATTTTGCAAAATTATAATGGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.60% | 2.40% | 8.08% | 21.90% | NA |
| All Indica | 2759 | 62.80% | 0.10% | 3.84% | 33.24% | NA |
| All Japonica | 1512 | 85.50% | 7.10% | 4.43% | 2.91% | NA |
| Aus | 269 | 3.70% | 0.00% | 71.75% | 24.54% | NA |
| Indica I | 595 | 89.60% | 0.00% | 2.86% | 7.56% | NA |
| Indica II | 465 | 33.10% | 0.00% | 2.58% | 64.30% | NA |
| Indica III | 913 | 61.80% | 0.10% | 2.85% | 35.27% | NA |
| Indica Intermediate | 786 | 61.50% | 0.10% | 6.49% | 31.93% | NA |
| Temperate Japonica | 767 | 96.20% | 0.80% | 2.61% | 0.39% | NA |
| Tropical Japonica | 504 | 82.70% | 6.20% | 3.77% | 7.34% | NA |
| Japonica Intermediate | 241 | 57.30% | 29.50% | 11.62% | 1.66% | NA |
| VI/Aromatic | 96 | 90.60% | 1.00% | 7.29% | 1.04% | NA |
| Intermediate | 90 | 78.90% | 3.30% | 10.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504875404 | C -> T | LOC_Os05g08830.1 | upstream_gene_variant ; 404.0bp to feature; MODIFIER | silent_mutation | Average:42.737; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0504875404 | C -> T | LOC_Os05g08840.1 | upstream_gene_variant ; 2219.0bp to feature; MODIFIER | silent_mutation | Average:42.737; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0504875404 | C -> T | LOC_Os05g08820-LOC_Os05g08830 | intergenic_region ; MODIFIER | silent_mutation | Average:42.737; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| vg0504875404 | C -> DEL | N | N | silent_mutation | Average:42.737; most accessible tissue: Zhenshan97 root, score: 84.061 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504875404 | NA | 3.69E-07 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504875404 | 6.63E-06 | 7.88E-09 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504875404 | 6.30E-06 | 1.41E-07 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504875404 | 3.40E-07 | 3.21E-12 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504875404 | NA | 1.13E-11 | mr1118 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504875404 | 1.26E-07 | 1.13E-10 | mr1119 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504875404 | 4.20E-07 | 5.90E-09 | mr1120 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504875404 | 4.98E-08 | 4.68E-13 | mr1123 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504875404 | NA | 7.76E-07 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504875404 | NA | 2.35E-08 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/