\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504875404:

Variant ID: vg0504875404 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4875404
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCATTATAATTTTGCAAAATTTGAGATATGCCATCCTGACCCACATGTCATTAACTCATGTGGGTCCTACATGTCATTGAGATACCGATGACATATCT[C/T]
AAACTTTGAAAAATTATAATGGTATGGTTCCAATTTACCCATAATCTTATGTATTTGTTTTCGATCTTACTCAACAATCTCGTCTTGACTTTAACTAACG

Reverse complement sequence

CGTTAGTTAAAGTCAAGACGAGATTGTTGAGTAAGATCGAAAACAAATACATAAGATTATGGGTAAATTGGAACCATACCATTATAATTTTTCAAAGTTT[G/A]
AGATATGTCATCGGTATCTCAATGACATGTAGGACCCACATGAGTTAATGACATGTGGGTCAGGATGGCATATCTCAAATTTTGCAAAATTATAATGGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.60% 2.40% 8.08% 21.90% NA
All Indica  2759 62.80% 0.10% 3.84% 33.24% NA
All Japonica  1512 85.50% 7.10% 4.43% 2.91% NA
Aus  269 3.70% 0.00% 71.75% 24.54% NA
Indica I  595 89.60% 0.00% 2.86% 7.56% NA
Indica II  465 33.10% 0.00% 2.58% 64.30% NA
Indica III  913 61.80% 0.10% 2.85% 35.27% NA
Indica Intermediate  786 61.50% 0.10% 6.49% 31.93% NA
Temperate Japonica  767 96.20% 0.80% 2.61% 0.39% NA
Tropical Japonica  504 82.70% 6.20% 3.77% 7.34% NA
Japonica Intermediate  241 57.30% 29.50% 11.62% 1.66% NA
VI/Aromatic  96 90.60% 1.00% 7.29% 1.04% NA
Intermediate  90 78.90% 3.30% 10.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504875404 C -> T LOC_Os05g08830.1 upstream_gene_variant ; 404.0bp to feature; MODIFIER silent_mutation Average:42.737; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0504875404 C -> T LOC_Os05g08840.1 upstream_gene_variant ; 2219.0bp to feature; MODIFIER silent_mutation Average:42.737; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0504875404 C -> T LOC_Os05g08820-LOC_Os05g08830 intergenic_region ; MODIFIER silent_mutation Average:42.737; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N
vg0504875404 C -> DEL N N silent_mutation Average:42.737; most accessible tissue: Zhenshan97 root, score: 84.061 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504875404 NA 3.69E-07 mr1113 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 6.63E-06 7.88E-09 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 6.30E-06 1.41E-07 mr1116 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 3.40E-07 3.21E-12 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 NA 1.13E-11 mr1118 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 1.26E-07 1.13E-10 mr1119 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 4.20E-07 5.90E-09 mr1120 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 4.98E-08 4.68E-13 mr1123 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 NA 7.76E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 NA 2.35E-08 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 4.69E-07 1.51E-12 mr1242 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 2.61E-06 9.40E-10 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 NA 3.72E-08 mr1495 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 8.88E-07 5.50E-12 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 NA 8.65E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 2.61E-06 5.58E-09 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 3.93E-06 5.68E-08 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 NA 1.36E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 3.09E-07 1.57E-10 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 4.67E-08 5.79E-12 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 1.00E-08 6.81E-14 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 7.85E-09 3.35E-14 mr1118_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 9.35E-09 1.75E-13 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 1.07E-07 1.28E-11 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 2.35E-08 1.16E-13 mr1123_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 3.31E-08 8.28E-14 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 5.86E-07 4.83E-12 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 1.01E-07 9.61E-12 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 4.18E-07 2.42E-11 mr1495_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 4.62E-10 2.34E-16 mr1496_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 9.62E-06 2.98E-09 mr1936_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504875404 NA 6.88E-07 mr1961_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251