\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504844339:

Variant ID: vg0504844339 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4844339
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTACTATAAAATTCTTTTGTAAGAAACACATCGTTTAATAGTTCGGAAAACATGCGCGTGGAAAACGAGTGAGTTTCTCTCTCTTTCCTCTTCTAAC[A/G]
AACACCTTAAGACTTCTTTGAAACACATGATGAAAGAAAATGGAGAAATAACAAAAAGATAAATATAGCGTTTGGACAAGAGAATATATAAAACTACATA

Reverse complement sequence

TATGTAGTTTTATATATTCTCTTGTCCAAACGCTATATTTATCTTTTTGTTATTTCTCCATTTTCTTTCATCATGTGTTTCAAAGAAGTCTTAAGGTGTT[T/C]
GTTAGAAGAGGAAAGAGAGAGAAACTCACTCGTTTTCCACGCGCATGTTTTCCGAACTATTAAACGATGTGTTTCTTACAAAAGAATTTTATAGTAAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.50% 2.50% 9.56% 18.43% NA
All Indica  2759 62.10% 2.70% 8.81% 26.46% NA
All Japonica  1512 92.90% 0.60% 6.02% 0.46% NA
Aus  269 3.30% 11.50% 39.78% 45.35% NA
Indica I  595 90.40% 0.20% 1.51% 7.90% NA
Indica II  465 31.20% 3.90% 14.41% 50.54% NA
Indica III  913 60.20% 3.40% 10.95% 25.41% NA
Indica Intermediate  786 60.90% 3.10% 8.52% 27.48% NA
Temperate Japonica  767 97.30% 0.00% 2.35% 0.39% NA
Tropical Japonica  504 88.30% 1.20% 10.12% 0.40% NA
Japonica Intermediate  241 88.80% 1.20% 9.13% 0.83% NA
VI/Aromatic  96 91.70% 1.00% 4.17% 3.12% NA
Intermediate  90 80.00% 2.20% 7.78% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504844339 A -> DEL N N silent_mutation Average:29.005; most accessible tissue: Callus, score: 50.038 N N N N
vg0504844339 A -> G LOC_Os05g08800.1 upstream_gene_variant ; 4478.0bp to feature; MODIFIER silent_mutation Average:29.005; most accessible tissue: Callus, score: 50.038 N N N N
vg0504844339 A -> G LOC_Os05g08800-LOC_Os05g08810 intergenic_region ; MODIFIER silent_mutation Average:29.005; most accessible tissue: Callus, score: 50.038 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504844339 7.65E-06 1.22E-12 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504844339 2.66E-08 NA Grain_width All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504844339 4.31E-10 9.35E-25 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504844339 NA 2.10E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504844339 NA 8.20E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504844339 NA 1.23E-07 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504844339 NA 5.56E-06 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504844339 NA 2.31E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504844339 NA 1.65E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504844339 NA 2.55E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504844339 NA 2.41E-06 mr1546_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251