\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504828513:

Variant ID: vg0504828513 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4828513
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GCGTCTTGCTTAGATGCTATGCAACACGAATGTGTTTATACTTCTTAGTTCTGTGGGATGGTTTGCTTCGTCCCACTCCTTCAATCAGAAGTATTGCAAG[C/T]
TGCTATTGTCATGCTATGGAGCCGGATCCAATCCCAGTCATCGTCTTAGGTAGATTTTGCCACCAGTGTATAGGAAGAAGGCAATTCCATTCACTGGAGA

Reverse complement sequence

TCTCCAGTGAATGGAATTGCCTTCTTCCTATACACTGGTGGCAAAATCTACCTAAGACGATGACTGGGATTGGATCCGGCTCCATAGCATGACAATAGCA[G/A]
CTTGCAATACTTCTGATTGAAGGAGTGGGACGAAGCAAACCATCCCACAGAACTAAGAAGTATAAACACATTCGTGTTGCATAGCATCTAAGCAAGACGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 32.10% 0.42% 0.00% NA
All Indica  2759 60.90% 38.40% 0.65% 0.00% NA
All Japonica  1512 93.10% 6.80% 0.07% 0.00% NA
Aus  269 1.90% 98.10% 0.00% 0.00% NA
Indica I  595 89.70% 10.30% 0.00% 0.00% NA
Indica II  465 29.20% 69.70% 1.08% 0.00% NA
Indica III  913 59.50% 39.80% 0.77% 0.00% NA
Indica Intermediate  786 59.50% 39.70% 0.76% 0.00% NA
Temperate Japonica  767 96.90% 3.10% 0.00% 0.00% NA
Tropical Japonica  504 87.50% 12.30% 0.20% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 76.70% 22.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504828513 C -> T LOC_Os05g08790.1 downstream_gene_variant ; 3332.0bp to feature; MODIFIER silent_mutation Average:73.969; most accessible tissue: Callus, score: 93.582 N N N N
vg0504828513 C -> T LOC_Os05g08780.1 intron_variant ; MODIFIER silent_mutation Average:73.969; most accessible tissue: Callus, score: 93.582 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504828513 NA 1.39E-12 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504828513 2.21E-07 NA Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504828513 5.29E-10 2.29E-25 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504828513 NA 5.72E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504828513 NA 7.38E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504828513 NA 6.32E-07 mr1438 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504828513 NA 5.76E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504828513 NA 4.37E-09 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504828513 NA 8.55E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504828513 NA 1.84E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504828513 2.58E-06 2.58E-06 mr1478_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504828513 NA 2.08E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251