\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504807237:

Variant ID: vg0504807237 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4807237
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.07, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


AGATAAGCACTATTTTCTAGTGGGGCGATTGGATTTACCTGTACAGAGCTAGGATTCTATGGTTCAGCGCCGTCGCCGGTGTGGAAGCCACAAAAATGAT[A/G]
GACATATGTACTTCGGTGCCCCTGGTGCAGCTTGCGTCTCCAAGCTCGTCATGGTCATCGACGTGCAGCCCCTGCCCCTGCTCCTAACACAACATCTACC

Reverse complement sequence

GGTAGATGTTGTGTTAGGAGCAGGGGCAGGGGCTGCACGTCGATGACCATGACGAGCTTGGAGACGCAAGCTGCACCAGGGGCACCGAAGTACATATGTC[T/C]
ATCATTTTTGTGGCTTCCACACCGGCGACGGCGCTGAACCATAGAATCCTAGCTCTGTACAGGTAAATCCAATCGCCCCACTAGAAAATAGTGCTTATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 32.80% 0.23% 0.04% NA
All Indica  2759 61.20% 38.30% 0.40% 0.07% NA
All Japonica  1512 90.80% 9.20% 0.00% 0.00% NA
Aus  269 1.50% 98.50% 0.00% 0.00% NA
Indica I  595 90.10% 9.70% 0.17% 0.00% NA
Indica II  465 28.80% 70.50% 0.43% 0.22% NA
Indica III  913 59.90% 39.60% 0.44% 0.00% NA
Indica Intermediate  786 59.90% 39.40% 0.51% 0.13% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 75.80% 24.20% 0.00% 0.00% NA
Japonica Intermediate  241 94.60% 5.40% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504807237 A -> DEL N N silent_mutation Average:78.057; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0504807237 A -> G LOC_Os05g08760.1 upstream_gene_variant ; 1705.0bp to feature; MODIFIER silent_mutation Average:78.057; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0504807237 A -> G LOC_Os05g08770.2 downstream_gene_variant ; 4811.0bp to feature; MODIFIER silent_mutation Average:78.057; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N
vg0504807237 A -> G LOC_Os05g08760-LOC_Os05g08770 intergenic_region ; MODIFIER silent_mutation Average:78.057; most accessible tissue: Minghui63 panicle, score: 88.893 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0504807237 A G -0.03 -0.02 -0.01 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504807237 NA 1.10E-12 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504807237 1.36E-06 NA Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504807237 6.51E-11 2.66E-25 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504807237 NA 2.24E-09 mr1183 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504807237 NA 1.15E-08 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504807237 NA 4.56E-11 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504807237 NA 7.20E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504807237 NA 2.44E-07 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504807237 NA 1.10E-06 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251