\
| Variant ID: vg0504757155 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4757155 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAAGCCTCTTGGGGAAGATCAACACCAATGACATGTACAAGTTGAAGAAGGAGGAGATGGAGGAAGCCTCACCTTCCAAGAAGTGCATTGCTCTCCAAGC[C/T]
GAAGTTGAAGATAAGGACAAGGGCAAGGTGAATGAAGCCAATGAGGACTTGGAGGAAGAGATTGTCCTTCTTGCTAGAAGGTTCAATGATCTCTTGGGAA
TTCCCAAGAGATCATTGAACCTTCTAGCAAGAAGGACAATCTCTTCCTCCAAGTCCTCATTGGCTTCATTCACCTTGCCCTTGTCCTTATCTTCAACTTC[G/A]
GCTTGGAGAGCAATGCACTTCTTGGAAGGTGAGGCTTCCTCCATCTCCTCCTTCTTCAACTTGTACATGTCATTGGTGTTGATCTTCCCCAAGAGGCTTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.40% | 36.20% | 5.14% | 2.20% | NA |
| All Indica | 2759 | 83.00% | 4.60% | 8.70% | 3.70% | NA |
| All Japonica | 1512 | 2.10% | 97.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 90.00% | 9.30% | 0.37% | 0.37% | NA |
| Indica I | 595 | 82.90% | 3.90% | 10.76% | 2.52% | NA |
| Indica II | 465 | 81.70% | 7.30% | 8.17% | 2.80% | NA |
| Indica III | 913 | 84.30% | 2.20% | 8.76% | 4.71% | NA |
| Indica Intermediate | 786 | 82.30% | 6.40% | 7.38% | 3.94% | NA |
| Temperate Japonica | 767 | 1.70% | 98.20% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 63.30% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504757155 | C -> T | LOC_Os05g08694.1 | synonymous_variant ; p.Ala126Ala; LOW | synonymous_codon | Average:17.289; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| vg0504757155 | C -> DEL | LOC_Os05g08694.1 | N | frameshift_variant | Average:17.289; most accessible tissue: Zhenshan97 flag leaf, score: 26.688 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504757155 | NA | 1.70E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 8.53E-16 | mr1324 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 5.93E-12 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 2.23E-14 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 3.10E-13 | mr1335 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 2.20E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 2.01E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 4.33E-10 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 9.03E-16 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 1.56E-13 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 3.90E-16 | mr1326_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 2.07E-15 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 5.48E-11 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 1.08E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 4.37E-16 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 2.04E-09 | mr1690_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504757155 | NA | 6.36E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |