\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504756490:

Variant ID: vg0504756490 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4756490
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATTAGGTGACATTCAGTTTTAAATCGCCTATTCACCCCCCTCTAGTCGACATCTCGATCCTACAAGTGGTATCAGAGCTTGGTCTCTCTTTATTGGG[T/C]
TTCACCGCCTAGAGAGAAGATGTCGAACGAGGTGAACCATGTTGGGAAGGCTCCTATGTTTAATGGCACAAACTACTCCACTTGGAAAATTAAAATGTCT

Reverse complement sequence

AGACATTTTAATTTTCCAAGTGGAGTAGTTTGTGCCATTAAACATAGGAGCCTTCCCAACATGGTTCACCTCGTTCGACATCTTCTCTCTAGGCGGTGAA[A/G]
CCCAATAAAGAGAGACCAAGCTCTGATACCACTTGTAGGATCGAGATGTCGACTAGAGGGGGGTGAATAGGCGATTTAAAACTGAATGTCACCTAATCAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 0.80% 12.48% 50.32% NA
All Indica  2759 5.60% 1.20% 10.11% 83.04% NA
All Japonica  1512 97.90% 0.00% 0.93% 1.19% NA
Aus  269 1.90% 0.70% 81.78% 15.61% NA
Indica I  595 4.90% 0.80% 2.52% 91.76% NA
Indica II  465 8.80% 2.20% 4.95% 84.09% NA
Indica III  913 2.60% 1.00% 15.22% 81.16% NA
Indica Intermediate  786 7.80% 1.30% 12.98% 77.99% NA
Temperate Japonica  767 98.20% 0.00% 0.13% 1.69% NA
Tropical Japonica  504 98.20% 0.00% 1.19% 0.60% NA
Japonica Intermediate  241 96.30% 0.00% 2.90% 0.83% NA
VI/Aromatic  96 25.00% 1.00% 70.83% 3.12% NA
Intermediate  90 62.20% 1.10% 10.00% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504756490 T -> DEL N N silent_mutation Average:22.771; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0504756490 T -> C LOC_Os05g08680.1 upstream_gene_variant ; 1732.0bp to feature; MODIFIER silent_mutation Average:22.771; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0504756490 T -> C LOC_Os05g08694.1 upstream_gene_variant ; 217.0bp to feature; MODIFIER silent_mutation Average:22.771; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0504756490 T -> C LOC_Os05g08670.1 downstream_gene_variant ; 3539.0bp to feature; MODIFIER silent_mutation Average:22.771; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0504756490 T -> C LOC_Os05g08680-LOC_Os05g08694 intergenic_region ; MODIFIER silent_mutation Average:22.771; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504756490 NA 2.08E-12 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.91E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.42E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 2.57E-08 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.41E-07 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.30E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 9.06E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.01E-17 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.59E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.52E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.03E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.89E-14 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.79E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 2.55E-07 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 5.68E-07 mr1373 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 7.71E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.65E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 8.20E-07 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 2.44E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 7.09E-06 NA mr1468 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 7.26E-06 7.26E-06 mr1468 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.76E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.40E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.18E-06 mr1516 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 6.04E-06 NA mr1523 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 8.13E-07 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.92E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 3.04E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.90E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.09E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.95E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 4.61E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 5.59E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 4.36E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 9.31E-08 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 9.31E-08 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504756490 NA 1.02E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251