\
| Variant ID: vg0504742919 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 4742919 |
| Reference Allele: A | Alternative Allele: G,AC |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAAAACCTGAAGGGGTACCTAGCTATATAAATAGGGGTAGGAGGACGACCTAGGGGTGCCTAGGGTCGTGCTCCACCTTGCTGGGGAGCACCCCACATGG[A/G,AC]
CCCCACCTGGGCCGGGATCCCAAATGAAGTTACAAGCCCATAGGCCCATTATAGGTGATGCAGCACCTTGTGCGTGTGATTCCGGCCACATGAGATGAAA
TTTCATCTCATGTGGCCGGAATCACACGCACAAGGTGCTGCATCACCTATAATGGGCCTATGGGCTTGTAACTTCATTTGGGATCCCGGCCCAGGTGGGG[T/C,GT]
CCATGTGGGGTGCTCCCCAGCAAGGTGGAGCACGACCCTAGGCACCCCTAGGTCGTCCTCCTACCCCTATTTATATAGCTAGGTACCCCTTCAGGTTTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.30% | 34.40% | 1.54% | 4.76% | NA |
| All Indica | 2759 | 89.30% | 2.60% | 2.28% | 5.73% | NA |
| All Japonica | 1512 | 1.50% | 97.90% | 0.07% | 0.60% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 0.70% | 2.18% | 1.18% | NA |
| Indica II | 465 | 90.30% | 5.80% | 1.51% | 2.37% | NA |
| Indica III | 913 | 87.00% | 1.20% | 2.19% | 9.64% | NA |
| Indica Intermediate | 786 | 86.50% | 3.90% | 2.93% | 6.62% | NA |
| Temperate Japonica | 767 | 1.80% | 98.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 0.60% | 98.40% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 2.10% | 96.30% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 16.70% | 24.00% | 2.08% | 57.29% | NA |
| Intermediate | 90 | 36.70% | 52.20% | 7.78% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504742919 | A -> DEL | N | N | silent_mutation | Average:38.093; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0504742919 | A -> G | LOC_Os05g08650.1 | upstream_gene_variant ; 3563.0bp to feature; MODIFIER | silent_mutation | Average:38.093; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0504742919 | A -> G | LOC_Os05g08660.1 | intron_variant ; MODIFIER | silent_mutation | Average:38.093; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0504742919 | A -> AC | LOC_Os05g08650.1 | upstream_gene_variant ; 3564.0bp to feature; MODIFIER | N | Average:38.093; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg0504742919 | A -> AC | LOC_Os05g08660.1 | intron_variant ; MODIFIER | N | Average:38.093; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504742919 | NA | 4.58E-33 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.40E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 7.96E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.37E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 1.26E-06 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 9.02E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 1.52E-08 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.32E-06 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.00E-11 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 5.08E-17 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | 4.80E-06 | 5.90E-19 | mr1324 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 7.83E-13 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 1.66E-15 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 5.44E-32 | mr1333 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | 4.61E-06 | 3.50E-16 | mr1335 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.48E-15 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 1.73E-06 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 4.66E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.38E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.21E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 6.25E-07 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.88E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 7.60E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.18E-11 | mr1623 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 1.48E-11 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.26E-06 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 5.90E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 4.59E-28 | mr1686 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 1.46E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 5.87E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 5.23E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 9.60E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.75E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.75E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.11E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 5.40E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 6.11E-22 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 7.70E-41 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.97E-24 | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 5.42E-35 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.27E-35 | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.65E-32 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 2.17E-42 | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 1.24E-34 | mr1181_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 4.30E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 6.34E-25 | mr1233_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 4.45E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.51E-62 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.25E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.05E-36 | mr1541_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 5.63E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504742919 | NA | 3.23E-22 | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |