Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504695747:

Variant ID: vg0504695747 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 4695747
Reference Allele: C	Alternative Allele: T,CGATAT
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

GTAACAAATGCGAGTAGTAAGAATAATAATGAGTAGAATTGTTAGTGCTCTGTCACAATTAAGAGTAAAGTGCACTCCCAGTACCCGAACTTGCAAATAG[C/T,CGATAT]
GATGTGGGTGCAATTTGATAGACAAACTTGTTTAGTACGTGCAAACCAAAGCTAAAAGAGCATACCATACTAATTTCATTAAGTTGAATATCTATATAGT

Reverse complement sequence

ACTATATAGATATTCAACTTAATGAAATTAGTATGGTATGCTCTTTTAGCTTTGGTTTGCACGTACTAAACAAGTTTGTCTATCAAATTGCACCCACATC[G/A,ATATCG]
CTATTTGCAAGTTCGGGTACTGGGAGTGCACTTTACTCTTAATTGTGACAGAGCACTAACAATTCTACTCATTATTATTCTTACTACTCGCATTTGTTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.30%	23.70%	0.00%	1.40%	CGATAT: 1.57%
All Indica	2759	95.40%	2.10%	0.00%	2.25%	CGATAT: 0.18%
All Japonica	1512	32.50%	67.10%	0.00%	0.00%	CGATAT: 0.40%
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	95.60%	0.20%	0.00%	4.20%	NA
Indica II	465	93.30%	6.00%	0.00%	0.65%	NA
Indica III	913	97.70%	0.70%	0.00%	1.20%	CGATAT: 0.44%
Indica Intermediate	786	93.90%	3.10%	0.00%	2.93%	CGATAT: 0.13%
Temperate Japonica	767	34.40%	65.40%	0.00%	0.00%	CGATAT: 0.13%
Tropical Japonica	504	17.90%	81.90%	0.00%	0.00%	CGATAT: 0.20%
Japonica Intermediate	241	57.30%	41.10%	0.00%	0.00%	CGATAT: 1.66%
VI/Aromatic	96	20.80%	14.60%	0.00%	0.00%	CGATAT: 64.58%
Intermediate	90	58.90%	35.60%	0.00%	4.44%	CGATAT: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504695747	C -> T	LOC_Os05g08580.1	upstream_gene_variant ; 3753.0bp to feature; MODIFIER	silent_mutation	Average:42.969; most accessible tissue: Callus, score: 67.445	N	N	N	N
vg0504695747	C -> T	LOC_Os05g08570-LOC_Os05g08580	intergenic_region ; MODIFIER	silent_mutation	Average:42.969; most accessible tissue: Callus, score: 67.445	N	N	N	N
vg0504695747	C -> CGATAT	LOC_Os05g08580.1	upstream_gene_variant ; 3752.0bp to feature; MODIFIER	silent_mutation	Average:42.969; most accessible tissue: Callus, score: 67.445	N	N	N	N
vg0504695747	C -> CGATAT	LOC_Os05g08570-LOC_Os05g08580	intergenic_region ; MODIFIER	silent_mutation	Average:42.969; most accessible tissue: Callus, score: 67.445	N	N	N	N
vg0504695747	C -> DEL	N	N	silent_mutation	Average:42.969; most accessible tissue: Callus, score: 67.445	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504695747	NA	5.54E-15	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747	NA	5.51E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747	NA	1.77E-10	mr1510	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747	NA	2.50E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747	NA	1.52E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747	NA	1.03E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747	NA	4.27E-08	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747	NA	4.64E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251