\
| Variant ID: vg0504695747 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 4695747 |
| Reference Allele: C | Alternative Allele: T,CGATAT |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 250. )
GTAACAAATGCGAGTAGTAAGAATAATAATGAGTAGAATTGTTAGTGCTCTGTCACAATTAAGAGTAAAGTGCACTCCCAGTACCCGAACTTGCAAATAG[C/T,CGATAT]
GATGTGGGTGCAATTTGATAGACAAACTTGTTTAGTACGTGCAAACCAAAGCTAAAAGAGCATACCATACTAATTTCATTAAGTTGAATATCTATATAGT
ACTATATAGATATTCAACTTAATGAAATTAGTATGGTATGCTCTTTTAGCTTTGGTTTGCACGTACTAAACAAGTTTGTCTATCAAATTGCACCCACATC[G/A,ATATCG]
CTATTTGCAAGTTCGGGTACTGGGAGTGCACTTTACTCTTAATTGTGACAGAGCACTAACAATTCTACTCATTATTATTCTTACTACTCGCATTTGTTAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.30% | 23.70% | 0.00% | 1.40% | CGATAT: 1.57% |
| All Indica | 2759 | 95.40% | 2.10% | 0.00% | 2.25% | CGATAT: 0.18% |
| All Japonica | 1512 | 32.50% | 67.10% | 0.00% | 0.00% | CGATAT: 0.40% |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.60% | 0.20% | 0.00% | 4.20% | NA |
| Indica II | 465 | 93.30% | 6.00% | 0.00% | 0.65% | NA |
| Indica III | 913 | 97.70% | 0.70% | 0.00% | 1.20% | CGATAT: 0.44% |
| Indica Intermediate | 786 | 93.90% | 3.10% | 0.00% | 2.93% | CGATAT: 0.13% |
| Temperate Japonica | 767 | 34.40% | 65.40% | 0.00% | 0.00% | CGATAT: 0.13% |
| Tropical Japonica | 504 | 17.90% | 81.90% | 0.00% | 0.00% | CGATAT: 0.20% |
| Japonica Intermediate | 241 | 57.30% | 41.10% | 0.00% | 0.00% | CGATAT: 1.66% |
| VI/Aromatic | 96 | 20.80% | 14.60% | 0.00% | 0.00% | CGATAT: 64.58% |
| Intermediate | 90 | 58.90% | 35.60% | 0.00% | 4.44% | CGATAT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504695747 | C -> T | LOC_Os05g08580.1 | upstream_gene_variant ; 3753.0bp to feature; MODIFIER | silent_mutation | Average:42.969; most accessible tissue: Callus, score: 67.445 | N | N | N | N |
| vg0504695747 | C -> T | LOC_Os05g08570-LOC_Os05g08580 | intergenic_region ; MODIFIER | silent_mutation | Average:42.969; most accessible tissue: Callus, score: 67.445 | N | N | N | N |
| vg0504695747 | C -> CGATAT | LOC_Os05g08580.1 | upstream_gene_variant ; 3752.0bp to feature; MODIFIER | silent_mutation | Average:42.969; most accessible tissue: Callus, score: 67.445 | N | N | N | N |
| vg0504695747 | C -> CGATAT | LOC_Os05g08570-LOC_Os05g08580 | intergenic_region ; MODIFIER | silent_mutation | Average:42.969; most accessible tissue: Callus, score: 67.445 | N | N | N | N |
| vg0504695747 | C -> DEL | N | N | silent_mutation | Average:42.969; most accessible tissue: Callus, score: 67.445 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504695747 | NA | 5.54E-15 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504695747 | NA | 5.51E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504695747 | NA | 1.77E-10 | mr1510 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504695747 | NA | 2.50E-11 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504695747 | NA | 1.52E-06 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504695747 | NA | 1.03E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504695747 | NA | 4.27E-08 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504695747 | NA | 4.64E-11 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |