\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504695747:

Variant ID: vg0504695747 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 4695747
Reference Allele: CAlternative Allele: T,CGATAT
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


GTAACAAATGCGAGTAGTAAGAATAATAATGAGTAGAATTGTTAGTGCTCTGTCACAATTAAGAGTAAAGTGCACTCCCAGTACCCGAACTTGCAAATAG[C/T,CGATAT]
GATGTGGGTGCAATTTGATAGACAAACTTGTTTAGTACGTGCAAACCAAAGCTAAAAGAGCATACCATACTAATTTCATTAAGTTGAATATCTATATAGT

Reverse complement sequence

ACTATATAGATATTCAACTTAATGAAATTAGTATGGTATGCTCTTTTAGCTTTGGTTTGCACGTACTAAACAAGTTTGTCTATCAAATTGCACCCACATC[G/A,ATATCG]
CTATTTGCAAGTTCGGGTACTGGGAGTGCACTTTACTCTTAATTGTGACAGAGCACTAACAATTCTACTCATTATTATTCTTACTACTCGCATTTGTTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.30% 23.70% 0.00% 1.40% CGATAT: 1.57%
All Indica  2759 95.40% 2.10% 0.00% 2.25% CGATAT: 0.18%
All Japonica  1512 32.50% 67.10% 0.00% 0.00% CGATAT: 0.40%
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.60% 0.20% 0.00% 4.20% NA
Indica II  465 93.30% 6.00% 0.00% 0.65% NA
Indica III  913 97.70% 0.70% 0.00% 1.20% CGATAT: 0.44%
Indica Intermediate  786 93.90% 3.10% 0.00% 2.93% CGATAT: 0.13%
Temperate Japonica  767 34.40% 65.40% 0.00% 0.00% CGATAT: 0.13%
Tropical Japonica  504 17.90% 81.90% 0.00% 0.00% CGATAT: 0.20%
Japonica Intermediate  241 57.30% 41.10% 0.00% 0.00% CGATAT: 1.66%
VI/Aromatic  96 20.80% 14.60% 0.00% 0.00% CGATAT: 64.58%
Intermediate  90 58.90% 35.60% 0.00% 4.44% CGATAT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504695747 C -> T LOC_Os05g08580.1 upstream_gene_variant ; 3753.0bp to feature; MODIFIER silent_mutation Average:42.969; most accessible tissue: Callus, score: 67.445 N N N N
vg0504695747 C -> T LOC_Os05g08570-LOC_Os05g08580 intergenic_region ; MODIFIER silent_mutation Average:42.969; most accessible tissue: Callus, score: 67.445 N N N N
vg0504695747 C -> CGATAT LOC_Os05g08580.1 upstream_gene_variant ; 3752.0bp to feature; MODIFIER silent_mutation Average:42.969; most accessible tissue: Callus, score: 67.445 N N N N
vg0504695747 C -> CGATAT LOC_Os05g08570-LOC_Os05g08580 intergenic_region ; MODIFIER silent_mutation Average:42.969; most accessible tissue: Callus, score: 67.445 N N N N
vg0504695747 C -> DEL N N silent_mutation Average:42.969; most accessible tissue: Callus, score: 67.445 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504695747 NA 5.54E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747 NA 5.51E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747 NA 1.77E-10 mr1510 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747 NA 2.50E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747 NA 1.52E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747 NA 1.03E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747 NA 4.27E-08 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504695747 NA 4.64E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251