\
| Variant ID: vg0504689285 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4689285 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 119. )
TATTTTCTTCATACCAAAGGGTAAAATAGACTTTATGGTAGGAATTTAACGGTCAACTAACGAAAGGGGTATAGAAGGGATTCAAACTGAAATTCAGAGG[T/C]
ATGGAAGGAAATAAACAAATTTCAGGGGTATAGAAGGGATTGTGTGAACTTTCAAGGGTACACAGGGAATTTCTCTTTTATGATCTATTCGTTGACTTAT
ATAAGTCAACGAATAGATCATAAAAGAGAAATTCCCTGTGTACCCTTGAAAGTTCACACAATCCCTTCTATACCCCTGAAATTTGTTTATTTCCTTCCAT[A/G]
CCTCTGAATTTCAGTTTGAATCCCTTCTATACCCCTTTCGTTAGTTGACCGTTAAATTCCTACCATAAAGTCTATTTTACCCTTTGGTATGAAGAAAATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.70% | 18.20% | 4.38% | 2.75% | NA |
| All Indica | 2759 | 60.00% | 30.70% | 7.03% | 2.28% | NA |
| All Japonica | 1512 | 99.20% | 0.30% | 0.13% | 0.40% | NA |
| Aus | 269 | 97.80% | 0.00% | 2.23% | 0.00% | NA |
| Indica I | 595 | 82.20% | 5.00% | 12.27% | 0.50% | NA |
| Indica II | 465 | 28.80% | 53.30% | 11.18% | 6.67% | NA |
| Indica III | 913 | 61.00% | 36.00% | 1.97% | 0.99% | NA |
| Indica Intermediate | 786 | 60.60% | 30.40% | 6.49% | 2.54% | NA |
| Temperate Japonica | 767 | 99.50% | 0.30% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.20% | 0.40% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.00% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 35.40% | 1.00% | 2.08% | 61.46% | NA |
| Intermediate | 90 | 86.70% | 7.80% | 3.33% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504689285 | T -> DEL | N | N | silent_mutation | Average:25.793; most accessible tissue: Callus, score: 57.411 | N | N | N | N |
| vg0504689285 | T -> C | LOC_Os05g08570.1 | upstream_gene_variant ; 4741.0bp to feature; MODIFIER | silent_mutation | Average:25.793; most accessible tissue: Callus, score: 57.411 | N | N | N | N |
| vg0504689285 | T -> C | LOC_Os05g08570.4 | upstream_gene_variant ; 4788.0bp to feature; MODIFIER | silent_mutation | Average:25.793; most accessible tissue: Callus, score: 57.411 | N | N | N | N |
| vg0504689285 | T -> C | LOC_Os05g08570.2 | upstream_gene_variant ; 4741.0bp to feature; MODIFIER | silent_mutation | Average:25.793; most accessible tissue: Callus, score: 57.411 | N | N | N | N |
| vg0504689285 | T -> C | LOC_Os05g08570.3 | upstream_gene_variant ; 4741.0bp to feature; MODIFIER | silent_mutation | Average:25.793; most accessible tissue: Callus, score: 57.411 | N | N | N | N |
| vg0504689285 | T -> C | LOC_Os05g08570.5 | upstream_gene_variant ; 4741.0bp to feature; MODIFIER | silent_mutation | Average:25.793; most accessible tissue: Callus, score: 57.411 | N | N | N | N |
| vg0504689285 | T -> C | LOC_Os05g08570-LOC_Os05g08580 | intergenic_region ; MODIFIER | silent_mutation | Average:25.793; most accessible tissue: Callus, score: 57.411 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504689285 | NA | 2.68E-09 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0504689285 | NA | 1.44E-18 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0504689285 | NA | 5.80E-06 | mr1032 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 1.89E-14 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 3.85E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 7.57E-15 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 2.10E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 3.38E-13 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 1.86E-08 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 1.18E-11 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 1.31E-07 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 1.71E-14 | mr1330_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 9.99E-09 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504689285 | NA | 5.79E-06 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |