Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504689285:

Variant ID: vg0504689285 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4689285
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTTCTTCATACCAAAGGGTAAAATAGACTTTATGGTAGGAATTTAACGGTCAACTAACGAAAGGGGTATAGAAGGGATTCAAACTGAAATTCAGAGG[T/C]
ATGGAAGGAAATAAACAAATTTCAGGGGTATAGAAGGGATTGTGTGAACTTTCAAGGGTACACAGGGAATTTCTCTTTTATGATCTATTCGTTGACTTAT

Reverse complement sequence

ATAAGTCAACGAATAGATCATAAAAGAGAAATTCCCTGTGTACCCTTGAAAGTTCACACAATCCCTTCTATACCCCTGAAATTTGTTTATTTCCTTCCAT[A/G]
CCTCTGAATTTCAGTTTGAATCCCTTCTATACCCCTTTCGTTAGTTGACCGTTAAATTCCTACCATAAAGTCTATTTTACCCTTTGGTATGAAGAAAATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	18.20%	4.38%	2.75%	NA
All Indica	2759	60.00%	30.70%	7.03%	2.28%	NA
All Japonica	1512	99.20%	0.30%	0.13%	0.40%	NA
Aus	269	97.80%	0.00%	2.23%	0.00%	NA
Indica I	595	82.20%	5.00%	12.27%	0.50%	NA
Indica II	465	28.80%	53.30%	11.18%	6.67%	NA
Indica III	913	61.00%	36.00%	1.97%	0.99%	NA
Indica Intermediate	786	60.60%	30.40%	6.49%	2.54%	NA
Temperate Japonica	767	99.50%	0.30%	0.13%	0.13%	NA
Tropical Japonica	504	99.20%	0.40%	0.20%	0.20%	NA
Japonica Intermediate	241	98.30%	0.00%	0.00%	1.66%	NA
VI/Aromatic	96	35.40%	1.00%	2.08%	61.46%	NA
Intermediate	90	86.70%	7.80%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504689285	T -> DEL	N	N	silent_mutation	Average:25.793; most accessible tissue: Callus, score: 57.411	N	N	N	N
vg0504689285	T -> C	LOC_Os05g08570.1	upstream_gene_variant ; 4741.0bp to feature; MODIFIER	silent_mutation	Average:25.793; most accessible tissue: Callus, score: 57.411	N	N	N	N
vg0504689285	T -> C	LOC_Os05g08570.4	upstream_gene_variant ; 4788.0bp to feature; MODIFIER	silent_mutation	Average:25.793; most accessible tissue: Callus, score: 57.411	N	N	N	N
vg0504689285	T -> C	LOC_Os05g08570.2	upstream_gene_variant ; 4741.0bp to feature; MODIFIER	silent_mutation	Average:25.793; most accessible tissue: Callus, score: 57.411	N	N	N	N
vg0504689285	T -> C	LOC_Os05g08570.3	upstream_gene_variant ; 4741.0bp to feature; MODIFIER	silent_mutation	Average:25.793; most accessible tissue: Callus, score: 57.411	N	N	N	N
vg0504689285	T -> C	LOC_Os05g08570.5	upstream_gene_variant ; 4741.0bp to feature; MODIFIER	silent_mutation	Average:25.793; most accessible tissue: Callus, score: 57.411	N	N	N	N
vg0504689285	T -> C	LOC_Os05g08570-LOC_Os05g08580	intergenic_region ; MODIFIER	silent_mutation	Average:25.793; most accessible tissue: Callus, score: 57.411	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504689285	NA	2.68E-09	Grain_thickness	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504689285	NA	1.44E-18	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504689285	NA	5.80E-06	mr1032	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	1.89E-14	mr1183	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	3.85E-07	mr1183	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	7.57E-15	mr1503	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	2.10E-07	mr1503	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	3.38E-13	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	1.86E-08	mr1794	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	1.18E-11	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	1.31E-07	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	1.71E-14	mr1330_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	9.99E-09	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285	NA	5.79E-06	mr1438_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251