\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504689285:

Variant ID: vg0504689285 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4689285
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


TATTTTCTTCATACCAAAGGGTAAAATAGACTTTATGGTAGGAATTTAACGGTCAACTAACGAAAGGGGTATAGAAGGGATTCAAACTGAAATTCAGAGG[T/C]
ATGGAAGGAAATAAACAAATTTCAGGGGTATAGAAGGGATTGTGTGAACTTTCAAGGGTACACAGGGAATTTCTCTTTTATGATCTATTCGTTGACTTAT

Reverse complement sequence

ATAAGTCAACGAATAGATCATAAAAGAGAAATTCCCTGTGTACCCTTGAAAGTTCACACAATCCCTTCTATACCCCTGAAATTTGTTTATTTCCTTCCAT[A/G]
CCTCTGAATTTCAGTTTGAATCCCTTCTATACCCCTTTCGTTAGTTGACCGTTAAATTCCTACCATAAAGTCTATTTTACCCTTTGGTATGAAGAAAATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.70% 18.20% 4.38% 2.75% NA
All Indica  2759 60.00% 30.70% 7.03% 2.28% NA
All Japonica  1512 99.20% 0.30% 0.13% 0.40% NA
Aus  269 97.80% 0.00% 2.23% 0.00% NA
Indica I  595 82.20% 5.00% 12.27% 0.50% NA
Indica II  465 28.80% 53.30% 11.18% 6.67% NA
Indica III  913 61.00% 36.00% 1.97% 0.99% NA
Indica Intermediate  786 60.60% 30.40% 6.49% 2.54% NA
Temperate Japonica  767 99.50% 0.30% 0.13% 0.13% NA
Tropical Japonica  504 99.20% 0.40% 0.20% 0.20% NA
Japonica Intermediate  241 98.30% 0.00% 0.00% 1.66% NA
VI/Aromatic  96 35.40% 1.00% 2.08% 61.46% NA
Intermediate  90 86.70% 7.80% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504689285 T -> DEL N N silent_mutation Average:25.793; most accessible tissue: Callus, score: 57.411 N N N N
vg0504689285 T -> C LOC_Os05g08570.1 upstream_gene_variant ; 4741.0bp to feature; MODIFIER silent_mutation Average:25.793; most accessible tissue: Callus, score: 57.411 N N N N
vg0504689285 T -> C LOC_Os05g08570.4 upstream_gene_variant ; 4788.0bp to feature; MODIFIER silent_mutation Average:25.793; most accessible tissue: Callus, score: 57.411 N N N N
vg0504689285 T -> C LOC_Os05g08570.2 upstream_gene_variant ; 4741.0bp to feature; MODIFIER silent_mutation Average:25.793; most accessible tissue: Callus, score: 57.411 N N N N
vg0504689285 T -> C LOC_Os05g08570.3 upstream_gene_variant ; 4741.0bp to feature; MODIFIER silent_mutation Average:25.793; most accessible tissue: Callus, score: 57.411 N N N N
vg0504689285 T -> C LOC_Os05g08570.5 upstream_gene_variant ; 4741.0bp to feature; MODIFIER silent_mutation Average:25.793; most accessible tissue: Callus, score: 57.411 N N N N
vg0504689285 T -> C LOC_Os05g08570-LOC_Os05g08580 intergenic_region ; MODIFIER silent_mutation Average:25.793; most accessible tissue: Callus, score: 57.411 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504689285 NA 2.68E-09 Grain_thickness Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504689285 NA 1.44E-18 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504689285 NA 5.80E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 1.89E-14 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 3.85E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 7.57E-15 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 2.10E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 3.38E-13 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 1.86E-08 mr1794 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 1.18E-11 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 1.31E-07 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 1.71E-14 mr1330_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 9.99E-09 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504689285 NA 5.79E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251