Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504661489:

Variant ID: vg0504661489 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4661489
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAGCTCCAAACACCATTGCATGTGAAGATATATTTGTATGGAAAAGTATTTTCTAATTGTGTATCATACATGTAGTTTAAATAGTTATAAAAAATCATA[G/A]
AATTTGATAAGATAGATTACAATAATAGTATAAAACACTATATAAATATGTAAAATTAAATTCGATCTACACACGAAGTAAAAATAACAAATTTTACTAG

Reverse complement sequence

CTAGTAAAATTTGTTATTTTTACTTCGTGTGTAGATCGAATTTAATTTTACATATTTATATAGTGTTTTATACTATTATTGTAATCTATCTTATCAAATT[C/T]
TATGATTTTTTATAACTATTTAAACTACATGTATGATACACAATTAGAAAATACTTTTCCATACAAATATATCTTCACATGCAATGGTGTTTGGAGCTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 34.20% 1.35% 0.40% NA
All Indica  2759 97.20% 2.40% 0.18% 0.25% NA
All Japonica  1512 1.50% 97.80% 0.46% 0.26% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 98.80% 0.50% 0.00% 0.67% NA
Indica II  465 93.80% 5.80% 0.00% 0.43% NA
Indica III  913 98.90% 0.50% 0.44% 0.11% NA
Indica Intermediate  786 96.10% 3.80% 0.13% 0.00% NA
Temperate Japonica  767 2.00% 97.90% 0.13% 0.00% NA
Tropical Japonica  504 0.60% 98.60% 0.40% 0.40% NA
Japonica Intermediate  241 2.10% 95.40% 1.66% 0.83% NA
VI/Aromatic  96 19.80% 24.00% 51.04% 5.21% NA
Intermediate  90 43.30% 50.00% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504661489 G -> DEL N N silent_mutation Average:77.595; most accessible tissue: Callus, score: 94.745 N N N N
vg0504661489 G -> A LOC_Os05g08530.1 downstream_gene_variant ; 3271.0bp to feature; MODIFIER silent_mutation Average:77.595; most accessible tissue: Callus, score: 94.745 N N N N
vg0504661489 G -> A LOC_Os05g08550.1 downstream_gene_variant ; 2134.0bp to feature; MODIFIER silent_mutation Average:77.595; most accessible tissue: Callus, score: 94.745 N N N N
vg0504661489 G -> A LOC_Os05g08554.1 downstream_gene_variant ; 3775.0bp to feature; MODIFIER silent_mutation Average:77.595; most accessible tissue: Callus, score: 94.745 N N N N
vg0504661489 G -> A LOC_Os05g08540.1 intron_variant ; MODIFIER silent_mutation Average:77.595; most accessible tissue: Callus, score: 94.745 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0504661489 G A 0.0 0.01 0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504661489 NA 1.92E-68 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 4.23E-38 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.19E-10 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.41E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 6.89E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.48E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 4.40E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.17E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.39E-29 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.69E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 5.28E-36 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.78E-72 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 5.85E-34 mr1932 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 7.32E-46 mr1070_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 3.84E-37 mr1082_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.01E-32 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.20E-34 mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.69E-101 mr1100_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 5.11E-68 mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 4.15E-39 mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.30E-35 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.62E-55 mr1136_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.16E-44 mr1145_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 3.29E-38 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 6.84E-36 mr1181_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 5.68E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.72E-38 mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 8.06E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 4.34E-40 mr1243_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.54E-42 mr1264_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 6.17E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.14E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 3.24E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 6.05E-69 mr1402_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 7.11E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.30E-50 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.53E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 4.20E-16 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.81E-45 mr1437_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.39E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 5.39E-47 mr1620_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.34E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.19E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 3.86E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 5.85E-64 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 1.40E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 4.92E-36 mr1878_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 3.75E-37 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504661489 NA 2.39E-23 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251