| Variant ID: vg0504617447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4617447 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTAAAAAAAAAATAAAGTTGGAAAAATTAATGTATAGAAATACTATATATAAAAAATATTTGAATTCAAAATCAAATTTGAAACGATTATGTAAACTTT[T/C]
GACTTATAAACTTTGGGTCTATAAATTAATATTTAAATTCAAATTTAAATTTGAATCGGGTATGTAAACTTTTGACTTATAAACTTTAGGTTTATAAACT
AGTTTATAAACCTAAAGTTTATAAGTCAAAAGTTTACATACCCGATTCAAATTTAAATTTGAATTTAAATATTAATTTATAGACCCAAAGTTTATAAGTC[A/G]
AAAGTTTACATAATCGTTTCAAATTTGATTTTGAATTCAAATATTTTTTATATATAGTATTTCTATACATTAATTTTTCCAACTTTATTTTTTTTTTAAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.90% | 42.10% | 1.42% | 1.52% | NA |
| All Indica | 2759 | 91.40% | 5.10% | 2.10% | 1.38% | NA |
| All Japonica | 1512 | 1.10% | 96.40% | 0.40% | 2.05% | NA |
| Aus | 269 | 9.30% | 90.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.40% | 2.90% | 2.18% | 1.51% | NA |
| Indica II | 465 | 87.10% | 6.00% | 4.30% | 2.58% | NA |
| Indica III | 913 | 96.40% | 2.70% | 0.33% | 0.55% | NA |
| Indica Intermediate | 786 | 86.60% | 9.00% | 2.80% | 1.53% | NA |
| Temperate Japonica | 767 | 1.60% | 94.70% | 0.13% | 3.65% | NA |
| Tropical Japonica | 504 | 0.60% | 98.40% | 0.60% | 0.40% | NA |
| Japonica Intermediate | 241 | 0.80% | 97.90% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 61.10% | 3.33% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504617447 | T -> DEL | N | N | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 80.639 | N | N | N | N |
| vg0504617447 | T -> C | LOC_Os05g08440.1 | downstream_gene_variant ; 4691.0bp to feature; MODIFIER | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 80.639 | N | N | N | N |
| vg0504617447 | T -> C | LOC_Os05g08450.1 | downstream_gene_variant ; 2145.0bp to feature; MODIFIER | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 80.639 | N | N | N | N |
| vg0504617447 | T -> C | LOC_Os05g08460.1 | downstream_gene_variant ; 4114.0bp to feature; MODIFIER | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 80.639 | N | N | N | N |
| vg0504617447 | T -> C | LOC_Os05g08450-LOC_Os05g08460 | intergenic_region ; MODIFIER | silent_mutation | Average:54.032; most accessible tissue: Callus, score: 80.639 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504617447 | 1.74E-08 | 8.73E-12 | mr1082 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504617447 | 1.07E-07 | 1.09E-09 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504617447 | NA | 4.93E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504617447 | NA | 2.92E-07 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504617447 | NA | 2.04E-06 | mr1104 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504617447 | NA | 2.06E-07 | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504617447 | NA | 8.72E-49 | mr1109 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504617447 | 1.18E-06 | 1.39E-07 | mr1155 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504617447 | NA | 3.54E-06 | mr1204 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504617447 | 5.86E-11 | 6.69E-13 | mr1226 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/