Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504617447:

Variant ID: vg0504617447 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4617447
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTAAAAAAAAAATAAAGTTGGAAAAATTAATGTATAGAAATACTATATATAAAAAATATTTGAATTCAAAATCAAATTTGAAACGATTATGTAAACTTT[T/C]
GACTTATAAACTTTGGGTCTATAAATTAATATTTAAATTCAAATTTAAATTTGAATCGGGTATGTAAACTTTTGACTTATAAACTTTAGGTTTATAAACT

Reverse complement sequence

AGTTTATAAACCTAAAGTTTATAAGTCAAAAGTTTACATACCCGATTCAAATTTAAATTTGAATTTAAATATTAATTTATAGACCCAAAGTTTATAAGTC[A/G]
AAAGTTTACATAATCGTTTCAAATTTGATTTTGAATTCAAATATTTTTTATATATAGTATTTCTATACATTAATTTTTCCAACTTTATTTTTTTTTTAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	42.10%	1.42%	1.52%	NA
All Indica	2759	91.40%	5.10%	2.10%	1.38%	NA
All Japonica	1512	1.10%	96.40%	0.40%	2.05%	NA
Aus	269	9.30%	90.70%	0.00%	0.00%	NA
Indica I	595	93.40%	2.90%	2.18%	1.51%	NA
Indica II	465	87.10%	6.00%	4.30%	2.58%	NA
Indica III	913	96.40%	2.70%	0.33%	0.55%	NA
Indica Intermediate	786	86.60%	9.00%	2.80%	1.53%	NA
Temperate Japonica	767	1.60%	94.70%	0.13%	3.65%	NA
Tropical Japonica	504	0.60%	98.40%	0.60%	0.40%	NA
Japonica Intermediate	241	0.80%	97.90%	0.83%	0.41%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	32.20%	61.10%	3.33%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504617447	T -> DEL	N	N	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 80.639	N	N	N	N
vg0504617447	T -> C	LOC_Os05g08440.1	downstream_gene_variant ; 4691.0bp to feature; MODIFIER	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 80.639	N	N	N	N
vg0504617447	T -> C	LOC_Os05g08450.1	downstream_gene_variant ; 2145.0bp to feature; MODIFIER	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 80.639	N	N	N	N
vg0504617447	T -> C	LOC_Os05g08460.1	downstream_gene_variant ; 4114.0bp to feature; MODIFIER	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 80.639	N	N	N	N
vg0504617447	T -> C	LOC_Os05g08450-LOC_Os05g08460	intergenic_region ; MODIFIER	silent_mutation	Average:54.032; most accessible tissue: Callus, score: 80.639	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504617447	1.74E-08	8.73E-12	mr1082	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	1.07E-07	1.09E-09	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	4.93E-06	mr1086	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	2.92E-07	mr1103	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	2.04E-06	mr1104	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	2.06E-07	mr1107	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	8.72E-49	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	1.18E-06	1.39E-07	mr1155	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	3.54E-06	mr1204	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	5.86E-11	6.69E-13	mr1226	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	1.89E-31	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	7.76E-25	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	1.03E-08	mr1411	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	4.17E-22	mr1422	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	8.01E-06	mr1437	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	8.72E-06	6.22E-09	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	6.15E-17	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	4.67E-12	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	1.84E-08	mr1929	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	3.32E-06	mr1949	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	1.14E-44	mr1094_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	4.30E-23	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	6.01E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	2.98E-39	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	7.61E-14	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	3.65E-08	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447	NA	3.27E-22	mr1877_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251