\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504617447:

Variant ID: vg0504617447 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4617447
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAAAAAAAAAATAAAGTTGGAAAAATTAATGTATAGAAATACTATATATAAAAAATATTTGAATTCAAAATCAAATTTGAAACGATTATGTAAACTTT[T/C]
GACTTATAAACTTTGGGTCTATAAATTAATATTTAAATTCAAATTTAAATTTGAATCGGGTATGTAAACTTTTGACTTATAAACTTTAGGTTTATAAACT

Reverse complement sequence

AGTTTATAAACCTAAAGTTTATAAGTCAAAAGTTTACATACCCGATTCAAATTTAAATTTGAATTTAAATATTAATTTATAGACCCAAAGTTTATAAGTC[A/G]
AAAGTTTACATAATCGTTTCAAATTTGATTTTGAATTCAAATATTTTTTATATATAGTATTTCTATACATTAATTTTTCCAACTTTATTTTTTTTTTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 42.10% 1.42% 1.52% NA
All Indica  2759 91.40% 5.10% 2.10% 1.38% NA
All Japonica  1512 1.10% 96.40% 0.40% 2.05% NA
Aus  269 9.30% 90.70% 0.00% 0.00% NA
Indica I  595 93.40% 2.90% 2.18% 1.51% NA
Indica II  465 87.10% 6.00% 4.30% 2.58% NA
Indica III  913 96.40% 2.70% 0.33% 0.55% NA
Indica Intermediate  786 86.60% 9.00% 2.80% 1.53% NA
Temperate Japonica  767 1.60% 94.70% 0.13% 3.65% NA
Tropical Japonica  504 0.60% 98.40% 0.60% 0.40% NA
Japonica Intermediate  241 0.80% 97.90% 0.83% 0.41% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 32.20% 61.10% 3.33% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504617447 T -> DEL N N silent_mutation Average:54.032; most accessible tissue: Callus, score: 80.639 N N N N
vg0504617447 T -> C LOC_Os05g08440.1 downstream_gene_variant ; 4691.0bp to feature; MODIFIER silent_mutation Average:54.032; most accessible tissue: Callus, score: 80.639 N N N N
vg0504617447 T -> C LOC_Os05g08450.1 downstream_gene_variant ; 2145.0bp to feature; MODIFIER silent_mutation Average:54.032; most accessible tissue: Callus, score: 80.639 N N N N
vg0504617447 T -> C LOC_Os05g08460.1 downstream_gene_variant ; 4114.0bp to feature; MODIFIER silent_mutation Average:54.032; most accessible tissue: Callus, score: 80.639 N N N N
vg0504617447 T -> C LOC_Os05g08450-LOC_Os05g08460 intergenic_region ; MODIFIER silent_mutation Average:54.032; most accessible tissue: Callus, score: 80.639 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504617447 1.74E-08 8.73E-12 mr1082 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 1.07E-07 1.09E-09 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 4.93E-06 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 2.92E-07 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 2.04E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 2.06E-07 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 8.72E-49 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 1.18E-06 1.39E-07 mr1155 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 3.54E-06 mr1204 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 5.86E-11 6.69E-13 mr1226 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 1.89E-31 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 7.76E-25 mr1411 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 1.03E-08 mr1411 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 4.17E-22 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 8.01E-06 mr1437 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 8.72E-06 6.22E-09 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 6.15E-17 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 4.67E-12 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 1.84E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 3.32E-06 mr1949 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 1.14E-44 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 4.30E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 6.01E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 2.98E-39 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 7.61E-14 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 3.65E-08 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504617447 NA 3.27E-22 mr1877_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251