\
| Variant ID: vg0504496687 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4496687 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )
TAAATTTGAAATGTGCTTCATCTGGATTTGTTATTTGTTGATACATTTTATGGTTGAAGAAGTGATGAAGGTGGTAAATTATTTGGCAGGTTCACTGTGC[C/T]
GTGTACAGTGGAAGGTGTTGGTAGCAGAACAAATATGCTGTATGATGTTGTTGTTTGTCTAAGTTTGAGCTGAATTTACGTTGTATGCCGTGTGCATAAT
ATTATGCACACGGCATACAACGTAAATTCAGCTCAAACTTAGACAAACAACAACATCATACAGCATATTTGTTCTGCTACCAACACCTTCCACTGTACAC[G/A]
GCACAGTGAACCTGCCAAATAATTTACCACCTTCATCACTTCTTCAACCATAAAATGTATCAACAAATAACAAATCCAGATGAAGCACATTTCAAATTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.00% | 15.90% | 11.89% | 7.19% | NA |
| All Indica | 2759 | 42.70% | 26.60% | 19.57% | 11.09% | NA |
| All Japonica | 1512 | 97.90% | 0.00% | 0.40% | 1.72% | NA |
| Aus | 269 | 97.00% | 1.10% | 1.12% | 0.74% | NA |
| Indica I | 595 | 33.60% | 23.40% | 21.18% | 21.85% | NA |
| Indica II | 465 | 24.50% | 43.00% | 24.73% | 7.74% | NA |
| Indica III | 913 | 60.50% | 17.10% | 16.21% | 6.24% | NA |
| Indica Intermediate | 786 | 39.70% | 30.50% | 19.21% | 10.56% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.26% | 1.04% | NA |
| Tropical Japonica | 504 | 95.60% | 0.00% | 0.79% | 3.57% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 4.20% | 5.21% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 10.00% | 8.89% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504496687 | C -> T | LOC_Os05g08250.1 | upstream_gene_variant ; 4347.0bp to feature; MODIFIER | silent_mutation | Average:7.161; most accessible tissue: Callus, score: 21.163 | N | N | N | N |
| vg0504496687 | C -> T | LOC_Os05g08240.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.161; most accessible tissue: Callus, score: 21.163 | N | N | N | N |
| vg0504496687 | C -> DEL | N | N | silent_mutation | Average:7.161; most accessible tissue: Callus, score: 21.163 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504496687 | NA | 5.58E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 3.05E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 2.54E-06 | mr1328 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 1.37E-08 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 4.46E-08 | mr1989 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 9.62E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 3.14E-06 | mr1121_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 1.21E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 3.58E-07 | mr1211_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 5.45E-07 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 8.76E-08 | mr1329_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 8.54E-07 | mr1337_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 3.06E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 3.25E-06 | mr1492_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 7.98E-08 | mr1508_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | 4.83E-07 | 1.58E-07 | mr1508_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 2.16E-07 | mr1524_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 6.97E-07 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 1.70E-07 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 3.34E-06 | mr1982_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504496687 | NA | 4.30E-06 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |