\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504475516:

Variant ID: vg0504475516 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4475516
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.40, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


GAGGCTTTGTGGGCCGAAAATGACCCACGGCCTAGAGAAAGGTTTTAAAACTTTTCCTTATTTGAATAATTCGTGAAATGCTATTTCGTTGATTAAAAAT[G/A]
CTTCCCTTGCTCAAATAATTCCCAGAAAAATCTAGAAAATAGATAAACAAGCAAAGTATTTAATGAAATTTTATCTAACTCAGTTTTATGTTGAATTTTT

Reverse complement sequence

AAAAATTCAACATAAAACTGAGTTAGATAAAATTTCATTAAATACTTTGCTTGTTTATCTATTTTCTAGATTTTTCTGGGAATTATTTGAGCAAGGGAAG[C/T]
ATTTTTAATCAACGAAATAGCATTTCACGAATTATTCAAATAAGGAAAAGTTTTAAAACCTTTCTCTAGGCCGTGGGTCATTTTCGGCCCACAAAGCCTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.30% 34.30% 10.37% 11.00% NA
All Indica  2759 58.80% 6.10% 16.96% 18.19% NA
All Japonica  1512 11.60% 87.80% 0.20% 0.40% NA
Aus  269 95.90% 0.70% 2.23% 1.12% NA
Indica I  595 49.10% 10.30% 21.34% 19.33% NA
Indica II  465 50.10% 7.30% 18.71% 23.87% NA
Indica III  913 66.00% 1.80% 12.81% 19.39% NA
Indica Intermediate  786 62.70% 7.30% 17.43% 12.60% NA
Temperate Japonica  767 1.30% 97.90% 0.26% 0.52% NA
Tropical Japonica  504 29.60% 70.00% 0.20% 0.20% NA
Japonica Intermediate  241 7.10% 92.50% 0.00% 0.41% NA
VI/Aromatic  96 14.60% 77.10% 5.21% 3.12% NA
Intermediate  90 28.90% 55.60% 8.89% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504475516 G -> DEL N N silent_mutation Average:40.585; most accessible tissue: Callus, score: 69.342 N N N N
vg0504475516 G -> A LOC_Os05g08210.1 upstream_gene_variant ; 1589.0bp to feature; MODIFIER silent_mutation Average:40.585; most accessible tissue: Callus, score: 69.342 N N N N
vg0504475516 G -> A LOC_Os05g08230.1 upstream_gene_variant ; 3028.0bp to feature; MODIFIER silent_mutation Average:40.585; most accessible tissue: Callus, score: 69.342 N N N N
vg0504475516 G -> A LOC_Os05g08220.1 intron_variant ; MODIFIER silent_mutation Average:40.585; most accessible tissue: Callus, score: 69.342 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504475516 NA 6.33E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516 NA 1.55E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516 NA 4.76E-15 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516 NA 1.45E-21 mr1175_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516 NA 3.33E-08 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516 NA 2.83E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516 NA 2.58E-06 mr1645_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516 1.65E-06 NA mr1861_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516 3.42E-06 NA mr1962_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251