Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0504475516:

Variant ID: vg0504475516 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4475516
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.40, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

GAGGCTTTGTGGGCCGAAAATGACCCACGGCCTAGAGAAAGGTTTTAAAACTTTTCCTTATTTGAATAATTCGTGAAATGCTATTTCGTTGATTAAAAAT[G/A]
CTTCCCTTGCTCAAATAATTCCCAGAAAAATCTAGAAAATAGATAAACAAGCAAAGTATTTAATGAAATTTTATCTAACTCAGTTTTATGTTGAATTTTT

Reverse complement sequence

AAAAATTCAACATAAAACTGAGTTAGATAAAATTTCATTAAATACTTTGCTTGTTTATCTATTTTCTAGATTTTTCTGGGAATTATTTGAGCAAGGGAAG[C/T]
ATTTTTAATCAACGAAATAGCATTTCACGAATTATTCAAATAAGGAAAAGTTTTAAAACCTTTCTCTAGGCCGTGGGTCATTTTCGGCCCACAAAGCCTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.30%	34.30%	10.37%	11.00%	NA
All Indica	2759	58.80%	6.10%	16.96%	18.19%	NA
All Japonica	1512	11.60%	87.80%	0.20%	0.40%	NA
Aus	269	95.90%	0.70%	2.23%	1.12%	NA
Indica I	595	49.10%	10.30%	21.34%	19.33%	NA
Indica II	465	50.10%	7.30%	18.71%	23.87%	NA
Indica III	913	66.00%	1.80%	12.81%	19.39%	NA
Indica Intermediate	786	62.70%	7.30%	17.43%	12.60%	NA
Temperate Japonica	767	1.30%	97.90%	0.26%	0.52%	NA
Tropical Japonica	504	29.60%	70.00%	0.20%	0.20%	NA
Japonica Intermediate	241	7.10%	92.50%	0.00%	0.41%	NA
VI/Aromatic	96	14.60%	77.10%	5.21%	3.12%	NA
Intermediate	90	28.90%	55.60%	8.89%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504475516	G -> DEL	N	N	silent_mutation	Average:40.585; most accessible tissue: Callus, score: 69.342	N	N	N	N
vg0504475516	G -> A	LOC_Os05g08210.1	upstream_gene_variant ; 1589.0bp to feature; MODIFIER	silent_mutation	Average:40.585; most accessible tissue: Callus, score: 69.342	N	N	N	N
vg0504475516	G -> A	LOC_Os05g08230.1	upstream_gene_variant ; 3028.0bp to feature; MODIFIER	silent_mutation	Average:40.585; most accessible tissue: Callus, score: 69.342	N	N	N	N
vg0504475516	G -> A	LOC_Os05g08220.1	intron_variant ; MODIFIER	silent_mutation	Average:40.585; most accessible tissue: Callus, score: 69.342	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504475516	NA	6.33E-09	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516	NA	1.55E-07	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516	NA	4.76E-15	mr1874	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516	NA	1.45E-21	mr1175_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516	NA	3.33E-08	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516	NA	2.83E-09	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516	NA	2.58E-06	mr1645_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516	1.65E-06	NA	mr1861_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475516	3.42E-06	NA	mr1962_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251