\
| Variant ID: vg0504475516 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4475516 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.61, A: 0.40, others allele: 0.00, population size: 82. )
GAGGCTTTGTGGGCCGAAAATGACCCACGGCCTAGAGAAAGGTTTTAAAACTTTTCCTTATTTGAATAATTCGTGAAATGCTATTTCGTTGATTAAAAAT[G/A]
CTTCCCTTGCTCAAATAATTCCCAGAAAAATCTAGAAAATAGATAAACAAGCAAAGTATTTAATGAAATTTTATCTAACTCAGTTTTATGTTGAATTTTT
AAAAATTCAACATAAAACTGAGTTAGATAAAATTTCATTAAATACTTTGCTTGTTTATCTATTTTCTAGATTTTTCTGGGAATTATTTGAGCAAGGGAAG[C/T]
ATTTTTAATCAACGAAATAGCATTTCACGAATTATTCAAATAAGGAAAAGTTTTAAAACCTTTCTCTAGGCCGTGGGTCATTTTCGGCCCACAAAGCCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.30% | 34.30% | 10.37% | 11.00% | NA |
| All Indica | 2759 | 58.80% | 6.10% | 16.96% | 18.19% | NA |
| All Japonica | 1512 | 11.60% | 87.80% | 0.20% | 0.40% | NA |
| Aus | 269 | 95.90% | 0.70% | 2.23% | 1.12% | NA |
| Indica I | 595 | 49.10% | 10.30% | 21.34% | 19.33% | NA |
| Indica II | 465 | 50.10% | 7.30% | 18.71% | 23.87% | NA |
| Indica III | 913 | 66.00% | 1.80% | 12.81% | 19.39% | NA |
| Indica Intermediate | 786 | 62.70% | 7.30% | 17.43% | 12.60% | NA |
| Temperate Japonica | 767 | 1.30% | 97.90% | 0.26% | 0.52% | NA |
| Tropical Japonica | 504 | 29.60% | 70.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 14.60% | 77.10% | 5.21% | 3.12% | NA |
| Intermediate | 90 | 28.90% | 55.60% | 8.89% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504475516 | G -> DEL | N | N | silent_mutation | Average:40.585; most accessible tissue: Callus, score: 69.342 | N | N | N | N |
| vg0504475516 | G -> A | LOC_Os05g08210.1 | upstream_gene_variant ; 1589.0bp to feature; MODIFIER | silent_mutation | Average:40.585; most accessible tissue: Callus, score: 69.342 | N | N | N | N |
| vg0504475516 | G -> A | LOC_Os05g08230.1 | upstream_gene_variant ; 3028.0bp to feature; MODIFIER | silent_mutation | Average:40.585; most accessible tissue: Callus, score: 69.342 | N | N | N | N |
| vg0504475516 | G -> A | LOC_Os05g08220.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.585; most accessible tissue: Callus, score: 69.342 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504475516 | NA | 6.33E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475516 | NA | 1.55E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475516 | NA | 4.76E-15 | mr1874 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475516 | NA | 1.45E-21 | mr1175_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475516 | NA | 3.33E-08 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475516 | NA | 2.83E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475516 | NA | 2.58E-06 | mr1645_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475516 | 1.65E-06 | NA | mr1861_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475516 | 3.42E-06 | NA | mr1962_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |