Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504475373:

Variant ID: vg0504475373 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4475373
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAGCTCGGGCTCAGTCGGCTGGCCTGAGGTTGAAGATGAACAATGCCGAGGGATGCATTGTAGACTTTCAGAGAAAAAGGAAAAGGAAAAGAAAAGAAAA[G/A]
AAAGGAATGGAGCAGCAGGCTGGCATGGCTGGCAGCCCGAGAGAGGCTTTGTGGGCCGAAAATGACCCACGGCCTAGAGAAAGGTTTTAAAACTTTTCCT

Reverse complement sequence

AGGAAAAGTTTTAAAACCTTTCTCTAGGCCGTGGGTCATTTTCGGCCCACAAAGCCTCTCTCGGGCTGCCAGCCATGCCAGCCTGCTGCTCCATTCCTTT[C/T]
TTTTCTTTTCTTTTCCTTTTCCTTTTTCTCTGAAAGTCTACAATGCATCCCTCGGCATTGTTCATCTTCAACCTCAGGCCAGCCGACTGAGCCCGAGCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.00%	5.50%	0.30%	8.25%	NA
All Indica	2759	84.60%	1.30%	0.43%	13.66%	NA
All Japonica	1512	88.80%	10.80%	0.07%	0.26%	NA
Aus	269	85.50%	13.80%	0.00%	0.74%	NA
Indica I	595	87.70%	0.00%	0.67%	11.60%	NA
Indica II	465	78.50%	3.00%	0.22%	18.28%	NA
Indica III	913	80.90%	0.20%	0.55%	18.29%	NA
Indica Intermediate	786	89.90%	2.70%	0.25%	7.12%	NA
Temperate Japonica	767	99.10%	0.50%	0.00%	0.39%	NA
Tropical Japonica	504	70.80%	29.00%	0.20%	0.00%	NA
Japonica Intermediate	241	93.80%	5.80%	0.00%	0.41%	NA
VI/Aromatic	96	86.50%	10.40%	0.00%	3.12%	NA
Intermediate	90	83.30%	11.10%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504475373	G -> DEL	N	N	silent_mutation	Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0504475373	G -> A	LOC_Os05g08200.1	upstream_gene_variant ; 4927.0bp to feature; MODIFIER	silent_mutation	Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0504475373	G -> A	LOC_Os05g08210.1	upstream_gene_variant ; 1446.0bp to feature; MODIFIER	silent_mutation	Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0504475373	G -> A	LOC_Os05g08230.1	upstream_gene_variant ; 3171.0bp to feature; MODIFIER	silent_mutation	Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N
vg0504475373	G -> A	LOC_Os05g08220.1	intron_variant ; MODIFIER	silent_mutation	Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504475373	NA	2.32E-06	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373	3.48E-07	3.48E-07	mr1362	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373	NA	1.32E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373	NA	5.00E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373	NA	3.18E-07	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373	NA	5.50E-10	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251