\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504475373:

Variant ID: vg0504475373 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4475373
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCTCGGGCTCAGTCGGCTGGCCTGAGGTTGAAGATGAACAATGCCGAGGGATGCATTGTAGACTTTCAGAGAAAAAGGAAAAGGAAAAGAAAAGAAAA[G/A]
AAAGGAATGGAGCAGCAGGCTGGCATGGCTGGCAGCCCGAGAGAGGCTTTGTGGGCCGAAAATGACCCACGGCCTAGAGAAAGGTTTTAAAACTTTTCCT

Reverse complement sequence

AGGAAAAGTTTTAAAACCTTTCTCTAGGCCGTGGGTCATTTTCGGCCCACAAAGCCTCTCTCGGGCTGCCAGCCATGCCAGCCTGCTGCTCCATTCCTTT[C/T]
TTTTCTTTTCTTTTCCTTTTCCTTTTTCTCTGAAAGTCTACAATGCATCCCTCGGCATTGTTCATCTTCAACCTCAGGCCAGCCGACTGAGCCCGAGCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 5.50% 0.30% 8.25% NA
All Indica  2759 84.60% 1.30% 0.43% 13.66% NA
All Japonica  1512 88.80% 10.80% 0.07% 0.26% NA
Aus  269 85.50% 13.80% 0.00% 0.74% NA
Indica I  595 87.70% 0.00% 0.67% 11.60% NA
Indica II  465 78.50% 3.00% 0.22% 18.28% NA
Indica III  913 80.90% 0.20% 0.55% 18.29% NA
Indica Intermediate  786 89.90% 2.70% 0.25% 7.12% NA
Temperate Japonica  767 99.10% 0.50% 0.00% 0.39% NA
Tropical Japonica  504 70.80% 29.00% 0.20% 0.00% NA
Japonica Intermediate  241 93.80% 5.80% 0.00% 0.41% NA
VI/Aromatic  96 86.50% 10.40% 0.00% 3.12% NA
Intermediate  90 83.30% 11.10% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504475373 G -> DEL N N silent_mutation Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0504475373 G -> A LOC_Os05g08200.1 upstream_gene_variant ; 4927.0bp to feature; MODIFIER silent_mutation Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0504475373 G -> A LOC_Os05g08210.1 upstream_gene_variant ; 1446.0bp to feature; MODIFIER silent_mutation Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0504475373 G -> A LOC_Os05g08230.1 upstream_gene_variant ; 3171.0bp to feature; MODIFIER silent_mutation Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N
vg0504475373 G -> A LOC_Os05g08220.1 intron_variant ; MODIFIER silent_mutation Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504475373 NA 2.32E-06 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373 3.48E-07 3.48E-07 mr1362 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373 NA 1.32E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373 NA 5.00E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373 NA 3.18E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504475373 NA 5.50E-10 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251