\
| Variant ID: vg0504475373 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4475373 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAGCTCGGGCTCAGTCGGCTGGCCTGAGGTTGAAGATGAACAATGCCGAGGGATGCATTGTAGACTTTCAGAGAAAAAGGAAAAGGAAAAGAAAAGAAAA[G/A]
AAAGGAATGGAGCAGCAGGCTGGCATGGCTGGCAGCCCGAGAGAGGCTTTGTGGGCCGAAAATGACCCACGGCCTAGAGAAAGGTTTTAAAACTTTTCCT
AGGAAAAGTTTTAAAACCTTTCTCTAGGCCGTGGGTCATTTTCGGCCCACAAAGCCTCTCTCGGGCTGCCAGCCATGCCAGCCTGCTGCTCCATTCCTTT[C/T]
TTTTCTTTTCTTTTCCTTTTCCTTTTTCTCTGAAAGTCTACAATGCATCCCTCGGCATTGTTCATCTTCAACCTCAGGCCAGCCGACTGAGCCCGAGCTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 5.50% | 0.30% | 8.25% | NA |
| All Indica | 2759 | 84.60% | 1.30% | 0.43% | 13.66% | NA |
| All Japonica | 1512 | 88.80% | 10.80% | 0.07% | 0.26% | NA |
| Aus | 269 | 85.50% | 13.80% | 0.00% | 0.74% | NA |
| Indica I | 595 | 87.70% | 0.00% | 0.67% | 11.60% | NA |
| Indica II | 465 | 78.50% | 3.00% | 0.22% | 18.28% | NA |
| Indica III | 913 | 80.90% | 0.20% | 0.55% | 18.29% | NA |
| Indica Intermediate | 786 | 89.90% | 2.70% | 0.25% | 7.12% | NA |
| Temperate Japonica | 767 | 99.10% | 0.50% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 70.80% | 29.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.80% | 5.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 86.50% | 10.40% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 83.30% | 11.10% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504475373 | G -> DEL | N | N | silent_mutation | Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0504475373 | G -> A | LOC_Os05g08200.1 | upstream_gene_variant ; 4927.0bp to feature; MODIFIER | silent_mutation | Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0504475373 | G -> A | LOC_Os05g08210.1 | upstream_gene_variant ; 1446.0bp to feature; MODIFIER | silent_mutation | Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0504475373 | G -> A | LOC_Os05g08230.1 | upstream_gene_variant ; 3171.0bp to feature; MODIFIER | silent_mutation | Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| vg0504475373 | G -> A | LOC_Os05g08220.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.319; most accessible tissue: Minghui63 young leaf, score: 68.745 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504475373 | NA | 2.32E-06 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475373 | 3.48E-07 | 3.48E-07 | mr1362 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475373 | NA | 1.32E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475373 | NA | 5.00E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475373 | NA | 3.18E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504475373 | NA | 5.50E-10 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |