\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504460143:

Variant ID: vg0504460143 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4460143
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTGTGCAAGATGGGACAAGCTTTCAAACTCTTGAGACGAAAACTTCTCCTTAATCAGAGCTATCAAACCCTGAAAAGCAAGATCGGCTAACTGGGAATC[A/G]
GTCAAAGCTAAGCTGTAACACCTATTCCTCATCTCTCTGAATCTCTGAATATAGTCTTGTACAGTTTCATCGTGCCTCTGTCTAACTGCTGTCAAATCAG

Reverse complement sequence

CTGATTTGACAGCAGTTAGACAGAGGCACGATGAAACTGTACAAGACTATATTCAGAGATTCAGAGAGATGAGGAATAGGTGTTACAGCTTAGCTTTGAC[T/C]
GATTCCCAGTTAGCCGATCTTGCTTTTCAGGGTTTGATAGCTCTGATTAAGGAGAAGTTTTCGTCTCAAGAGTTTGAAAGCTTGTCCCATCTTGCACAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 13.80% 9.86% 39.23% NA
All Indica  2759 10.70% 7.70% 16.56% 65.06% NA
All Japonica  1512 87.70% 11.10% 0.00% 1.19% NA
Aus  269 3.70% 89.20% 0.74% 6.32% NA
Indica I  595 19.20% 3.90% 11.43% 65.55% NA
Indica II  465 12.70% 6.20% 14.41% 66.67% NA
Indica III  913 2.20% 9.10% 21.25% 67.47% NA
Indica Intermediate  786 13.00% 9.80% 16.28% 60.94% NA
Temperate Japonica  767 97.90% 0.50% 0.00% 1.56% NA
Tropical Japonica  504 70.00% 29.20% 0.00% 0.79% NA
Japonica Intermediate  241 92.10% 7.10% 0.00% 0.83% NA
VI/Aromatic  96 75.00% 14.60% 3.12% 7.29% NA
Intermediate  90 57.80% 18.90% 4.44% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504460143 A -> DEL LOC_Os05g08170.1 N frameshift_variant Average:9.907; most accessible tissue: Zhenshan97 young leaf, score: 21.499 N N N N
vg0504460143 A -> G LOC_Os05g08170.1 synonymous_variant ; p.Thr323Thr; LOW synonymous_codon Average:9.907; most accessible tissue: Zhenshan97 young leaf, score: 21.499 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504460143 NA 2.69E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 1.78E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 4.21E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 4.44E-07 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 6.99E-08 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 8.70E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 7.23E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 1.30E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 1.81E-14 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 2.28E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 9.05E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 1.37E-06 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 8.23E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 3.17E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 6.08E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 4.78E-06 mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 1.86E-06 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 3.34E-06 4.47E-06 mr1240_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 4.69E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504460143 NA 4.35E-07 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251