\
| Variant ID: vg0504458914 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4458914 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 92. )
CCATCATCTTGGACATCGGATTCCTATTGACAAACCCATTAACGTATAATGGCTTAAGGTGCCGATTTTCTGTCCCCTCTGGCTTCTCAAAGATTGCTTG[C/T]
TCTAGTGACAAAATCAACATAGCAGAGGCCTCCTCTACATCATCAACATCGGCTTCTTTAGCTTCAAATTCTACAGGAAGCATGGAGACCATGTTCACCG
CGGTGAACATGGTCTCCATGCTTCCTGTAGAATTTGAAGCTAAAGAAGCCGATGTTGATGATGTAGAGGAGGCCTCTGCTATGTTGATTTTGTCACTAGA[G/A]
CAAGCAATCTTTGAGAAGCCAGAGGGGACAGAAAATCGGCACCTTAAGCCATTATACGTTAATGGGTTTGTCAATAGGAATCCGATGTCCAAGATGATGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.10% | 41.70% | 8.17% | 1.99% | NA |
| All Indica | 2759 | 18.90% | 69.00% | 11.63% | 0.43% | NA |
| All Japonica | 1512 | 93.70% | 0.80% | 1.39% | 4.17% | NA |
| Aus | 269 | 78.40% | 8.20% | 8.18% | 5.20% | NA |
| Indica I | 595 | 20.70% | 67.10% | 11.93% | 0.34% | NA |
| Indica II | 465 | 25.80% | 61.70% | 11.83% | 0.65% | NA |
| Indica III | 913 | 11.70% | 77.10% | 11.06% | 0.11% | NA |
| Indica Intermediate | 786 | 21.90% | 65.40% | 11.96% | 0.76% | NA |
| Temperate Japonica | 767 | 98.80% | 0.90% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 86.50% | 0.80% | 3.17% | 9.52% | NA |
| Japonica Intermediate | 241 | 92.10% | 0.40% | 1.66% | 5.81% | NA |
| VI/Aromatic | 96 | 66.70% | 14.60% | 16.67% | 2.08% | NA |
| Intermediate | 90 | 68.90% | 21.10% | 6.67% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504458914 | C -> T | LOC_Os05g08170.1 | synonymous_variant ; p.Glu493Glu; LOW | synonymous_codon | Average:12.73; most accessible tissue: Callus, score: 35.786 | N | N | N | N |
| vg0504458914 | C -> DEL | LOC_Os05g08170.1 | N | frameshift_variant | Average:12.73; most accessible tissue: Callus, score: 35.786 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504458914 | NA | 2.00E-44 | mr1721 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 9.19E-06 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 3.15E-55 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 7.17E-36 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 1.28E-14 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 3.18E-17 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 7.48E-22 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 1.40E-20 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 5.34E-29 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 4.52E-22 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | 1.62E-06 | 1.62E-06 | mr1367_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 4.69E-06 | mr1825_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 2.92E-06 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504458914 | NA | 6.39E-61 | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |