\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504429178:

Variant ID: vg0504429178 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4429178
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TGAAGCACTTGAACTTAACCCGATGATGTGTACCGAGTCGTATTGTCGGAATTGGCTCAATCGGCTACCTTGTCCGACTCGAACTCTGCCGATTCTGGTC[G/A]
TAGCCGATTCGGACTTCAGTCGATTCTTGCTCTATTTCCGGAACGATCTTTCTCTTGGATTCCGCTTCGGTTTTATCTTCATCTTCTATACTGAAATTTC

Reverse complement sequence

GAAATTTCAGTATAGAAGATGAAGATAAAACCGAAGCGGAATCCAAGAGAAAGATCGTTCCGGAAATAGAGCAAGAATCGACTGAAGTCCGAATCGGCTA[C/T]
GACCAGAATCGGCAGAGTTCGAGTCGGACAAGGTAGCCGATTGAGCCAATTCCGACAATACGACTCGGTACACATCATCGGGTTAAGTTCAAGTGCTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 3.00% 3.66% 0.00% NA
All Indica  2759 88.80% 5.10% 6.09% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 98.10% 1.10% 0.74% 0.00% NA
Indica I  595 67.10% 14.30% 18.66% 0.00% NA
Indica II  465 94.60% 1.50% 3.87% 0.00% NA
Indica III  913 97.40% 2.30% 0.33% 0.00% NA
Indica Intermediate  786 92.00% 3.40% 4.58% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504429178 G -> A LOC_Os05g08130.1 upstream_gene_variant ; 378.0bp to feature; MODIFIER silent_mutation Average:33.159; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0504429178 G -> A LOC_Os05g08120-LOC_Os05g08130 intergenic_region ; MODIFIER silent_mutation Average:33.159; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504429178 NA 7.34E-06 mr1104 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 8.03E-06 mr1107 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 9.87E-06 3.85E-07 mr1131 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 7.14E-06 mr1187 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 7.58E-08 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 6.59E-06 mr1233 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 6.22E-06 3.33E-06 mr1327 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 4.44E-06 5.82E-07 mr1327 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 5.97E-06 NA mr1330 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 7.23E-07 7.17E-08 mr1330 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 9.40E-06 mr1332 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 6.43E-06 mr1404 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 1.94E-06 mr1538 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 5.54E-06 NA mr1544 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 5.63E-09 mr1547 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 3.67E-07 mr1547 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 1.08E-06 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 2.11E-06 mr1620 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 9.83E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 5.87E-06 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 6.56E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 5.47E-06 1.51E-06 mr1763 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 4.38E-06 4.38E-06 mr1770 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 1.72E-06 1.72E-06 mr1787 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504429178 NA 5.61E-07 mr1949 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251