\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504297582:

Variant ID: vg0504297582 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4297582
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GTCACGATGCCATGTCAGCTAAAAGTCATCCCGAGGCTGGTTTGGACCACTAATGGGCGCATAATCGAGTTTAGGGACGTTAAAGTGCAATTTGAGAGTA[T/C]
AGGGACCTAGATGACACACCTCGACAAGTTTGAGGACCGCCGGTACACTTCACTCAATAAAAAAGCTATGCAAAGAGTACTTGAACGGAAAATAGAGGGA

Reverse complement sequence

TCCCTCTATTTTCCGTTCAAGTACTCTTTGCATAGCTTTTTTATTGAGTGAAGTGTACCGGCGGTCCTCAAACTTGTCGAGGTGTGTCATCTAGGTCCCT[A/G]
TACTCTCAAATTGCACTTTAACGTCCCTAAACTCGATTATGCGCCCATTAGTGGTCCAAACCAGCCTCGGGATGACTTTTAGCTGACATGGCATCGTGAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 7.60% 0.83% 0.74% NA
All Indica  2759 98.90% 0.80% 0.29% 0.00% NA
All Japonica  1512 74.10% 21.80% 1.79% 2.31% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.00% 0.84% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.50% 0.38% 0.00% NA
Temperate Japonica  767 95.40% 3.30% 1.30% 0.00% NA
Tropical Japonica  504 41.50% 50.40% 2.38% 5.75% NA
Japonica Intermediate  241 74.70% 20.70% 2.07% 2.49% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 8.90% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504297582 T -> DEL N N silent_mutation Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0504297582 T -> C LOC_Os05g07940.1 upstream_gene_variant ; 3851.0bp to feature; MODIFIER silent_mutation Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0504297582 T -> C LOC_Os05g07940.2 upstream_gene_variant ; 3851.0bp to feature; MODIFIER silent_mutation Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0504297582 T -> C LOC_Os05g07940.5 upstream_gene_variant ; 3851.0bp to feature; MODIFIER silent_mutation Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0504297582 T -> C LOC_Os05g07940.3 upstream_gene_variant ; 3965.0bp to feature; MODIFIER silent_mutation Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0504297582 T -> C LOC_Os05g07940.4 upstream_gene_variant ; 3965.0bp to feature; MODIFIER silent_mutation Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0504297582 T -> C LOC_Os05g07920.1 downstream_gene_variant ; 2805.0bp to feature; MODIFIER silent_mutation Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0504297582 T -> C LOC_Os05g07930.1 intron_variant ; MODIFIER silent_mutation Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504297582 NA 6.54E-07 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582 NA 4.34E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582 NA 1.15E-06 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582 NA 1.98E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582 NA 9.58E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582 4.98E-08 NA mr1850_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582 1.99E-06 NA mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251