\
| Variant ID: vg0504297582 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4297582 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 295. )
GTCACGATGCCATGTCAGCTAAAAGTCATCCCGAGGCTGGTTTGGACCACTAATGGGCGCATAATCGAGTTTAGGGACGTTAAAGTGCAATTTGAGAGTA[T/C]
AGGGACCTAGATGACACACCTCGACAAGTTTGAGGACCGCCGGTACACTTCACTCAATAAAAAAGCTATGCAAAGAGTACTTGAACGGAAAATAGAGGGA
TCCCTCTATTTTCCGTTCAAGTACTCTTTGCATAGCTTTTTTATTGAGTGAAGTGTACCGGCGGTCCTCAAACTTGTCGAGGTGTGTCATCTAGGTCCCT[A/G]
TACTCTCAAATTGCACTTTAACGTCCCTAAACTCGATTATGCGCCCATTAGTGGTCCAAACCAGCCTCGGGATGACTTTTAGCTGACATGGCATCGTGAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 7.60% | 0.83% | 0.74% | NA |
| All Indica | 2759 | 98.90% | 0.80% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 74.10% | 21.80% | 1.79% | 2.31% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.00% | 0.84% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.10% | 1.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 3.30% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 41.50% | 50.40% | 2.38% | 5.75% | NA |
| Japonica Intermediate | 241 | 74.70% | 20.70% | 2.07% | 2.49% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 8.90% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504297582 | T -> DEL | N | N | silent_mutation | Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0504297582 | T -> C | LOC_Os05g07940.1 | upstream_gene_variant ; 3851.0bp to feature; MODIFIER | silent_mutation | Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0504297582 | T -> C | LOC_Os05g07940.2 | upstream_gene_variant ; 3851.0bp to feature; MODIFIER | silent_mutation | Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0504297582 | T -> C | LOC_Os05g07940.5 | upstream_gene_variant ; 3851.0bp to feature; MODIFIER | silent_mutation | Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0504297582 | T -> C | LOC_Os05g07940.3 | upstream_gene_variant ; 3965.0bp to feature; MODIFIER | silent_mutation | Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0504297582 | T -> C | LOC_Os05g07940.4 | upstream_gene_variant ; 3965.0bp to feature; MODIFIER | silent_mutation | Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0504297582 | T -> C | LOC_Os05g07920.1 | downstream_gene_variant ; 2805.0bp to feature; MODIFIER | silent_mutation | Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| vg0504297582 | T -> C | LOC_Os05g07930.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504297582 | NA | 6.54E-07 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504297582 | NA | 4.34E-06 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504297582 | NA | 1.15E-06 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504297582 | NA | 1.98E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504297582 | NA | 9.58E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504297582 | 4.98E-08 | NA | mr1850_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504297582 | 1.99E-06 | NA | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |