Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504297582:

Variant ID: vg0504297582 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 4297582
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

GTCACGATGCCATGTCAGCTAAAAGTCATCCCGAGGCTGGTTTGGACCACTAATGGGCGCATAATCGAGTTTAGGGACGTTAAAGTGCAATTTGAGAGTA[T/C]
AGGGACCTAGATGACACACCTCGACAAGTTTGAGGACCGCCGGTACACTTCACTCAATAAAAAAGCTATGCAAAGAGTACTTGAACGGAAAATAGAGGGA

Reverse complement sequence

TCCCTCTATTTTCCGTTCAAGTACTCTTTGCATAGCTTTTTTATTGAGTGAAGTGTACCGGCGGTCCTCAAACTTGTCGAGGTGTGTCATCTAGGTCCCT[A/G]
TACTCTCAAATTGCACTTTAACGTCCCTAAACTCGATTATGCGCCCATTAGTGGTCCAAACCAGCCTCGGGATGACTTTTAGCTGACATGGCATCGTGAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	7.60%	0.83%	0.74%	NA
All Indica	2759	98.90%	0.80%	0.29%	0.00%	NA
All Japonica	1512	74.10%	21.80%	1.79%	2.31%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.20%	0.00%	0.84%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.50%	0.38%	0.00%	NA
Temperate Japonica	767	95.40%	3.30%	1.30%	0.00%	NA
Tropical Japonica	504	41.50%	50.40%	2.38%	5.75%	NA
Japonica Intermediate	241	74.70%	20.70%	2.07%	2.49%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	8.90%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0504297582	T -> DEL	N	N	silent_mutation	Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0504297582	T -> C	LOC_Os05g07940.1	upstream_gene_variant ; 3851.0bp to feature; MODIFIER	silent_mutation	Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0504297582	T -> C	LOC_Os05g07940.2	upstream_gene_variant ; 3851.0bp to feature; MODIFIER	silent_mutation	Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0504297582	T -> C	LOC_Os05g07940.5	upstream_gene_variant ; 3851.0bp to feature; MODIFIER	silent_mutation	Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0504297582	T -> C	LOC_Os05g07940.3	upstream_gene_variant ; 3965.0bp to feature; MODIFIER	silent_mutation	Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0504297582	T -> C	LOC_Os05g07940.4	upstream_gene_variant ; 3965.0bp to feature; MODIFIER	silent_mutation	Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0504297582	T -> C	LOC_Os05g07920.1	downstream_gene_variant ; 2805.0bp to feature; MODIFIER	silent_mutation	Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0504297582	T -> C	LOC_Os05g07930.1	intron_variant ; MODIFIER	silent_mutation	Average:50.452; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0504297582	NA	6.54E-07	mr1040	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582	NA	4.34E-06	mr1224	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582	NA	1.15E-06	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582	NA	1.98E-06	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582	NA	9.58E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582	4.98E-08	NA	mr1850_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504297582	1.99E-06	NA	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251