\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504159174:

Variant ID: vg0504159174 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4159174
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAAGAAAGTAGGTATAGATAATTAAAGAAGGGTTATGATTGGTGGAGAAGAGAATGGTTGCGATTGGTTGAGATAAGAGGGCAGGTGAAAAAATAGCTT[C/T]
ATTTTGGTACAAATCACATTTTAGAACGGATGTAGTAAGTAGTAGCTTAAAATTACTGGATTAATATAATTTTATAAAGTAACTTTCATATTGAATTTTT

Reverse complement sequence

AAAAATTCAATATGAAAGTTACTTTATAAAATTATATTAATCCAGTAATTTTAAGCTACTACTTACTACATCCGTTCTAAAATGTGATTTGTACCAAAAT[G/A]
AAGCTATTTTTTCACCTGCCCTCTTATCTCAACCAATCGCAACCATTCTCTTCTCCACCAATCATAACCCTTCTTTAATTATCTATACCTACTTTCTTAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.00% 3.40% 14.43% 18.13% NA
All Indica  2759 63.40% 0.00% 12.94% 23.60% NA
All Japonica  1512 78.00% 10.40% 9.85% 1.65% NA
Aus  269 4.80% 0.00% 36.43% 58.74% NA
Indica I  595 35.60% 0.00% 16.13% 48.24% NA
Indica II  465 72.00% 0.20% 13.55% 14.19% NA
Indica III  913 76.50% 0.00% 10.51% 13.03% NA
Indica Intermediate  786 64.20% 0.00% 12.98% 22.77% NA
Temperate Japonica  767 93.70% 3.10% 2.48% 0.65% NA
Tropical Japonica  504 68.30% 18.10% 13.29% 0.40% NA
Japonica Intermediate  241 48.50% 17.80% 26.14% 7.47% NA
VI/Aromatic  96 20.80% 0.00% 63.54% 15.62% NA
Intermediate  90 68.90% 3.30% 18.89% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504159174 C -> T LOC_Os05g07720.1 downstream_gene_variant ; 3279.0bp to feature; MODIFIER silent_mutation Average:33.601; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0504159174 C -> T LOC_Os05g07730.1 downstream_gene_variant ; 1878.0bp to feature; MODIFIER silent_mutation Average:33.601; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0504159174 C -> T LOC_Os05g07720-LOC_Os05g07730 intergenic_region ; MODIFIER silent_mutation Average:33.601; most accessible tissue: Minghui63 root, score: 49.234 N N N N
vg0504159174 C -> DEL N N silent_mutation Average:33.601; most accessible tissue: Minghui63 root, score: 49.234 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504159174 NA 2.33E-06 mr1040 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 NA 1.58E-06 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 NA 2.57E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 5.66E-06 1.75E-15 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 NA 6.85E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 NA 9.72E-08 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 1.41E-06 9.50E-18 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 9.82E-07 3.20E-17 mr1410_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 NA 3.77E-06 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 NA 2.13E-07 mr1632_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504159174 NA 7.34E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251