\
| Variant ID: vg0504159174 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 4159174 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTAAGAAAGTAGGTATAGATAATTAAAGAAGGGTTATGATTGGTGGAGAAGAGAATGGTTGCGATTGGTTGAGATAAGAGGGCAGGTGAAAAAATAGCTT[C/T]
ATTTTGGTACAAATCACATTTTAGAACGGATGTAGTAAGTAGTAGCTTAAAATTACTGGATTAATATAATTTTATAAAGTAACTTTCATATTGAATTTTT
AAAAATTCAATATGAAAGTTACTTTATAAAATTATATTAATCCAGTAATTTTAAGCTACTACTTACTACATCCGTTCTAAAATGTGATTTGTACCAAAAT[G/A]
AAGCTATTTTTTCACCTGCCCTCTTATCTCAACCAATCGCAACCATTCTCTTCTCCACCAATCATAACCCTTCTTTAATTATCTATACCTACTTTCTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.00% | 3.40% | 14.43% | 18.13% | NA |
| All Indica | 2759 | 63.40% | 0.00% | 12.94% | 23.60% | NA |
| All Japonica | 1512 | 78.00% | 10.40% | 9.85% | 1.65% | NA |
| Aus | 269 | 4.80% | 0.00% | 36.43% | 58.74% | NA |
| Indica I | 595 | 35.60% | 0.00% | 16.13% | 48.24% | NA |
| Indica II | 465 | 72.00% | 0.20% | 13.55% | 14.19% | NA |
| Indica III | 913 | 76.50% | 0.00% | 10.51% | 13.03% | NA |
| Indica Intermediate | 786 | 64.20% | 0.00% | 12.98% | 22.77% | NA |
| Temperate Japonica | 767 | 93.70% | 3.10% | 2.48% | 0.65% | NA |
| Tropical Japonica | 504 | 68.30% | 18.10% | 13.29% | 0.40% | NA |
| Japonica Intermediate | 241 | 48.50% | 17.80% | 26.14% | 7.47% | NA |
| VI/Aromatic | 96 | 20.80% | 0.00% | 63.54% | 15.62% | NA |
| Intermediate | 90 | 68.90% | 3.30% | 18.89% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0504159174 | C -> T | LOC_Os05g07720.1 | downstream_gene_variant ; 3279.0bp to feature; MODIFIER | silent_mutation | Average:33.601; most accessible tissue: Minghui63 root, score: 49.234 | N | N | N | N |
| vg0504159174 | C -> T | LOC_Os05g07730.1 | downstream_gene_variant ; 1878.0bp to feature; MODIFIER | silent_mutation | Average:33.601; most accessible tissue: Minghui63 root, score: 49.234 | N | N | N | N |
| vg0504159174 | C -> T | LOC_Os05g07720-LOC_Os05g07730 | intergenic_region ; MODIFIER | silent_mutation | Average:33.601; most accessible tissue: Minghui63 root, score: 49.234 | N | N | N | N |
| vg0504159174 | C -> DEL | N | N | silent_mutation | Average:33.601; most accessible tissue: Minghui63 root, score: 49.234 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0504159174 | NA | 2.33E-06 | mr1040 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | NA | 1.58E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | NA | 2.57E-14 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | 5.66E-06 | 1.75E-15 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | NA | 6.85E-13 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | NA | 9.72E-08 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | 1.41E-06 | 9.50E-18 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | 9.82E-07 | 3.20E-17 | mr1410_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | NA | 3.77E-06 | mr1510_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | NA | 2.13E-07 | mr1632_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0504159174 | NA | 7.34E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |