\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0504049977:

Variant ID: vg0504049977 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 4049977
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCATGGATTCTAATAGCTCGAGTGAATGTCCACCCATTTATTACATGTCAACTAAATAATTACGAAAAAATTTAAAAAAAATTGACAAGATAGATCAAT[T/A]
TGTAGTATATCACTCCACATACATGCAAGTTCAAATTTAACTTCTACAAATTGTAACAAAAATAACAAATTTAATTGTAAATATACATATAGTAATTTGA

Reverse complement sequence

TCAAATTACTATATGTATATTTACAATTAAATTTGTTATTTTTGTTACAATTTGTAGAAGTTAAATTTGAACTTGCATGTATGTGGAGTGATATACTACA[A/T]
ATTGATCTATCTTGTCAATTTTTTTTAAATTTTTTCGTAATTATTTAGTTGACATGTAATAAATGGGTGGACATTCACTCGAGCTATTAGAATCCATGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 10.60% 2.94% 17.35% NA
All Indica  2759 91.00% 3.80% 1.45% 3.77% NA
All Japonica  1512 37.20% 25.70% 5.95% 31.08% NA
Aus  269 13.80% 1.10% 2.23% 82.90% NA
Indica I  595 85.90% 9.10% 3.53% 1.51% NA
Indica II  465 91.00% 4.50% 1.51% 3.01% NA
Indica III  913 97.20% 0.40% 0.00% 2.41% NA
Indica Intermediate  786 87.70% 3.30% 1.53% 7.51% NA
Temperate Japonica  767 45.40% 43.50% 7.69% 3.39% NA
Tropical Japonica  504 28.60% 2.20% 3.17% 66.07% NA
Japonica Intermediate  241 29.50% 18.30% 6.22% 46.06% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 67.80% 6.70% 3.33% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0504049977 T -> DEL N N silent_mutation Average:56.816; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0504049977 T -> A LOC_Os05g07560.1 downstream_gene_variant ; 1957.0bp to feature; MODIFIER silent_mutation Average:56.816; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N
vg0504049977 T -> A LOC_Os05g07560-LOC_Os05g07580 intergenic_region ; MODIFIER silent_mutation Average:56.816; most accessible tissue: Zhenshan97 panicle, score: 85.254 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0504049977 T A 0.03 0.03 0.02 0.02 0.03 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0504049977 2.73E-07 NA Grain_thickness All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504049977 NA 4.04E-14 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504049977 NA 1.48E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0504049977 NA 9.93E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504049977 1.09E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504049977 4.42E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504049977 3.09E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504049977 NA 5.89E-14 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0504049977 NA 5.39E-09 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251