\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503985420:

Variant ID: vg0503985420 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3985420
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCTCATGGACGGTTCGCAATTTCGGTTCAAAATTTCCAAAATATCATACCCCACCGTTGCGAAACTATTTCATCCGATACTTTTTTATATTTTTGTTT[G/A]
TGAATTTAGCAAAATTTAATTCATTCAGTTTTCTTTCTTTCGGTTCAAAAATATCTAAAATTCCTGAAATTTAATTTGGTACCCTCGATTTATGCATACC

Reverse complement sequence

GGTATGCATAAATCGAGGGTACCAAATTAAATTTCAGGAATTTTAGATATTTTTGAACCGAAAGAAAGAAAACTGAATGAATTAAATTTTGCTAAATTCA[C/T]
AAACAAAAATATAAAAAAGTATCGGATGAAATAGTTTCGCAACGGTGGGGTATGATATTTTGGAAATTTTGAACCGAAATTGCGAACCGTCCATGAGACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.20% 11.30% 0.11% 1.33% NA
All Indica  2759 99.30% 0.70% 0.00% 0.04% NA
All Japonica  1512 67.40% 28.20% 0.33% 4.10% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.30% 0.00% 0.13% NA
Temperate Japonica  767 96.00% 3.90% 0.00% 0.13% NA
Tropical Japonica  504 29.60% 67.50% 0.60% 2.38% NA
Japonica Intermediate  241 55.60% 23.20% 0.83% 20.33% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503985420 G -> DEL N N silent_mutation Average:44.503; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0503985420 G -> A LOC_Os05g07470.1 upstream_gene_variant ; 1820.0bp to feature; MODIFIER silent_mutation Average:44.503; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg0503985420 G -> A LOC_Os05g07470-LOC_Os05g07480 intergenic_region ; MODIFIER silent_mutation Average:44.503; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503985420 4.25E-06 NA Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503985420 NA 1.90E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503985420 NA 1.60E-12 Grain_width Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503985420 NA 1.20E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 2.01E-07 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 1.81E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 4.21E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 1.86E-08 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 2.36E-16 mr1771 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 1.80E-14 mr1784 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 1.59E-09 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 1.13E-07 mr1862 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 3.77E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 3.01E-06 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 7.90E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 1.76E-09 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 2.47E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 5.71E-14 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 1.12E-16 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 4.28E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 3.18E-11 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 2.76E-11 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503985420 NA 3.51E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251