\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503966024:

Variant ID: vg0503966024 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3966024
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTCTTACTACTACATAATTCATTTTTACAGAAATCTTCCTTTATTTTTACAAATCATAAAAGATGACCCTTATGTGAATGTACGAGATATACCATCAA[G/A]
GACTGCATATGAAAATTGATTTCCACAGGCGGGCCTATTAAGTTTAGCTATGTACACGCACACCTTGCTCTCTCGTGCGTACCACTATGTCCCCTCCCTC

Reverse complement sequence

GAGGGAGGGGACATAGTGGTACGCACGAGAGAGCAAGGTGTGCGTGTACATAGCTAAACTTAATAGGCCCGCCTGTGGAAATCAATTTTCATATGCAGTC[C/T]
TTGATGGTATATCTCGTACATTCACATAAGGGTCATCTTTTATGATTTGTAAAAATAAAGGAAGATTTCTGTAAAAATGAATTATGTAGTAGTAAGACAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.00% 9.80% 1.76% 1.48% NA
All Indica  2759 82.60% 15.50% 1.85% 0.04% NA
All Japonica  1512 93.60% 0.10% 1.79% 4.56% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 83.00% 12.90% 4.03% 0.00% NA
Indica II  465 88.40% 10.50% 1.08% 0.00% NA
Indica III  913 74.40% 24.80% 0.88% 0.00% NA
Indica Intermediate  786 88.40% 9.70% 1.78% 0.13% NA
Temperate Japonica  767 97.70% 0.00% 2.22% 0.13% NA
Tropical Japonica  504 96.80% 0.20% 0.20% 2.78% NA
Japonica Intermediate  241 73.90% 0.00% 3.73% 22.41% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 90.00% 4.40% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503966024 G -> DEL N N silent_mutation Average:57.45; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg0503966024 G -> A LOC_Os05g07440.1 downstream_gene_variant ; 1215.0bp to feature; MODIFIER silent_mutation Average:57.45; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg0503966024 G -> A LOC_Os05g07450.1 downstream_gene_variant ; 4946.0bp to feature; MODIFIER silent_mutation Average:57.45; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N
vg0503966024 G -> A LOC_Os05g07430-LOC_Os05g07440 intergenic_region ; MODIFIER silent_mutation Average:57.45; most accessible tissue: Zhenshan97 young leaf, score: 82.539 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503966024 5.13E-06 NA mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503966024 2.02E-07 NA mr1005 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503966024 NA 8.37E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503966024 NA 6.49E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251