\
| Variant ID: vg0503843762 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3843762 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAAAAAAGAACCCTTTTATTCTGAGATATTTTCACACAGTCTACATATATAAAAGCAAAAGACAAAAATACACTGAAGAAAAAAAAAACCTCAATTAATA[C/T]
TAGCAGAAAGCTCAGCTAAAATAGGGGACATTCTCGTTGGTGATGGAGCTATAGTCCGTGGAGCTCGACGCGGCGGCGTACACCGCCGTCGTCGACGACG
CGTCGTCGACGACGGCGGTGTACGCCGCCGCGTCGAGCTCCACGGACTATAGCTCCATCACCAACGAGAATGTCCCCTATTTTAGCTGAGCTTTCTGCTA[G/A]
TATTAATTGAGGTTTTTTTTTTCTTCAGTGTATTTTTGTCTTTTGCTTTTATATATGTAGACTGTGTGAAAATATCTCAGAATAAAAGGGTTCTTTTTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 72.50% | 27.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.10% | 65.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503843762 | C -> T | LOC_Os05g07250.1 | downstream_gene_variant ; 4432.0bp to feature; MODIFIER | silent_mutation | Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 | N | N | N | N |
| vg0503843762 | C -> T | LOC_Os05g07260.1 | downstream_gene_variant ; 593.0bp to feature; MODIFIER | silent_mutation | Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 | N | N | N | N |
| vg0503843762 | C -> T | LOC_Os05g07270.1 | downstream_gene_variant ; 12.0bp to feature; MODIFIER | silent_mutation | Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 | N | N | N | N |
| vg0503843762 | C -> T | LOC_Os05g07260.2 | downstream_gene_variant ; 604.0bp to feature; MODIFIER | silent_mutation | Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 | N | N | N | N |
| vg0503843762 | C -> T | LOC_Os05g07260.4 | downstream_gene_variant ; 604.0bp to feature; MODIFIER | silent_mutation | Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 | N | N | N | N |
| vg0503843762 | C -> T | LOC_Os05g07260.3 | downstream_gene_variant ; 593.0bp to feature; MODIFIER | silent_mutation | Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 | N | N | N | N |
| vg0503843762 | C -> T | LOC_Os05g07260-LOC_Os05g07270 | intergenic_region ; MODIFIER | silent_mutation | Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503843762 | NA | 1.55E-08 | mr1248 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 7.39E-09 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 1.18E-22 | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 1.48E-14 | mr1410 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 2.06E-06 | mr1510 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 4.90E-09 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 2.95E-31 | mr1699 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 4.06E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 1.31E-23 | mr1301_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 2.01E-09 | mr1398_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 6.83E-06 | mr1398_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 1.59E-14 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | 1.39E-06 | NA | mr1671_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 3.86E-07 | mr1696_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 1.89E-29 | mr1699_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 3.02E-12 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 2.01E-07 | mr1705_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503843762 | NA | 9.16E-12 | mr1993_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |