Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503843762:

Variant ID: vg0503843762 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3843762
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAAAAAGAACCCTTTTATTCTGAGATATTTTCACACAGTCTACATATATAAAAGCAAAAGACAAAAATACACTGAAGAAAAAAAAAACCTCAATTAATA[C/T]
TAGCAGAAAGCTCAGCTAAAATAGGGGACATTCTCGTTGGTGATGGAGCTATAGTCCGTGGAGCTCGACGCGGCGGCGTACACCGCCGTCGTCGACGACG

Reverse complement sequence

CGTCGTCGACGACGGCGGTGTACGCCGCCGCGTCGAGCTCCACGGACTATAGCTCCATCACCAACGAGAATGTCCCCTATTTTAGCTGAGCTTTCTGCTA[G/A]
TATTAATTGAGGTTTTTTTTTTCTTCAGTGTATTTTTGTCTTTTGCTTTTATATATGTAGACTGTGTGAAAATATCTCAGAATAAAAGGGTTCTTTTTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.80%	9.20%	0.00%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	72.50%	27.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	96.10%	3.90%	0.00%	0.00%	NA
Tropical Japonica	504	34.10%	65.90%	0.00%	0.00%	NA
Japonica Intermediate	241	77.60%	22.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503843762	C -> T	LOC_Os05g07250.1	downstream_gene_variant ; 4432.0bp to feature; MODIFIER	silent_mutation	Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912	N	N	N	N
vg0503843762	C -> T	LOC_Os05g07260.1	downstream_gene_variant ; 593.0bp to feature; MODIFIER	silent_mutation	Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912	N	N	N	N
vg0503843762	C -> T	LOC_Os05g07270.1	downstream_gene_variant ; 12.0bp to feature; MODIFIER	silent_mutation	Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912	N	N	N	N
vg0503843762	C -> T	LOC_Os05g07260.2	downstream_gene_variant ; 604.0bp to feature; MODIFIER	silent_mutation	Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912	N	N	N	N
vg0503843762	C -> T	LOC_Os05g07260.4	downstream_gene_variant ; 604.0bp to feature; MODIFIER	silent_mutation	Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912	N	N	N	N
vg0503843762	C -> T	LOC_Os05g07260.3	downstream_gene_variant ; 593.0bp to feature; MODIFIER	silent_mutation	Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912	N	N	N	N
vg0503843762	C -> T	LOC_Os05g07260-LOC_Os05g07270	intergenic_region ; MODIFIER	silent_mutation	Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503843762	NA	1.55E-08	mr1248	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	7.39E-09	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	1.18E-22	mr1301	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	1.48E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	2.06E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	4.90E-09	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	2.95E-31	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	4.06E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	1.31E-23	mr1301_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	2.01E-09	mr1398_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	6.83E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	1.59E-14	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	1.39E-06	NA	mr1671_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	3.86E-07	mr1696_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	1.89E-29	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	3.02E-12	mr1705_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	2.01E-07	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762	NA	9.16E-12	mr1993_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251