\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503843762:

Variant ID: vg0503843762 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3843762
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAAAAGAACCCTTTTATTCTGAGATATTTTCACACAGTCTACATATATAAAAGCAAAAGACAAAAATACACTGAAGAAAAAAAAAACCTCAATTAATA[C/T]
TAGCAGAAAGCTCAGCTAAAATAGGGGACATTCTCGTTGGTGATGGAGCTATAGTCCGTGGAGCTCGACGCGGCGGCGTACACCGCCGTCGTCGACGACG

Reverse complement sequence

CGTCGTCGACGACGGCGGTGTACGCCGCCGCGTCGAGCTCCACGGACTATAGCTCCATCACCAACGAGAATGTCCCCTATTTTAGCTGAGCTTTCTGCTA[G/A]
TATTAATTGAGGTTTTTTTTTTCTTCAGTGTATTTTTGTCTTTTGCTTTTATATATGTAGACTGTGTGAAAATATCTCAGAATAAAAGGGTTCTTTTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.80% 9.20% 0.00% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 72.50% 27.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 34.10% 65.90% 0.00% 0.00% NA
Japonica Intermediate  241 77.60% 22.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503843762 C -> T LOC_Os05g07250.1 downstream_gene_variant ; 4432.0bp to feature; MODIFIER silent_mutation Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg0503843762 C -> T LOC_Os05g07260.1 downstream_gene_variant ; 593.0bp to feature; MODIFIER silent_mutation Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg0503843762 C -> T LOC_Os05g07270.1 downstream_gene_variant ; 12.0bp to feature; MODIFIER silent_mutation Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg0503843762 C -> T LOC_Os05g07260.2 downstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg0503843762 C -> T LOC_Os05g07260.4 downstream_gene_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg0503843762 C -> T LOC_Os05g07260.3 downstream_gene_variant ; 593.0bp to feature; MODIFIER silent_mutation Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N
vg0503843762 C -> T LOC_Os05g07260-LOC_Os05g07270 intergenic_region ; MODIFIER silent_mutation Average:72.188; most accessible tissue: Zhenshan97 root, score: 82.912 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503843762 NA 1.55E-08 mr1248 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 7.39E-09 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 1.18E-22 mr1301 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 1.48E-14 mr1410 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 2.06E-06 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 4.90E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 2.95E-31 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 4.06E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 1.31E-23 mr1301_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 2.01E-09 mr1398_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 6.83E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 1.59E-14 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 1.39E-06 NA mr1671_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 3.86E-07 mr1696_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 1.89E-29 mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 3.02E-12 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 2.01E-07 mr1705_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503843762 NA 9.16E-12 mr1993_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251