\
| Variant ID: vg0503683293 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 3683293 |
| Reference Allele: GA | Alternative Allele: TA,G |
| Primary Allele: TA | Secondary Allele: GA |
Inferred Ancestral Allele: Not determined.
TGACTTGCTGATCTCGCGCGTACGCGCTAATTAGCAATCTCGATCTTCACCACTGCAACGGCTCTCTTCTCCTTGCTCATCAAGGTTAAATAAAAGAAAA[GA/TA,G]
AAAAAAAAAGAAAAAAAACTTTCTTTGCCTACTGCCGCTTTTATTTCTTGCGCTCTAGCCGTCGAACATCAATTGTGCCTGATGATGTCCTCTTCATCAG
CTGATGAAGAGGACATCATCAGGCACAATTGATGTTCGACGGCTAGAGCGCAAGAAATAAAAGCGGCAGTAGGCAAAGAAAGTTTTTTTTCTTTTTTTTT[TC/TA,C]
TTTTCTTTTATTTAACCTTGATGAGCAAGGAGAAGAGAGCCGTTGCAGTGGTGAAGATCGAGATTGCTAATTAGCGCGTACGCGCGAGATCAGCAAGTCA
| Populations | Population Size | Frequency of TA(primary allele) | Frequency of GA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.30% | 40.10% | 2.86% | 1.78% | G: 5.99% |
| All Indica | 2759 | 81.00% | 18.30% | 0.11% | 0.00% | G: 0.62% |
| All Japonica | 1512 | 1.50% | 69.00% | 7.47% | 5.56% | G: 16.47% |
| Aus | 269 | 11.20% | 83.30% | 4.09% | 0.00% | G: 1.49% |
| Indica I | 595 | 96.00% | 3.90% | 0.00% | 0.00% | G: 0.17% |
| Indica II | 465 | 81.70% | 18.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 71.00% | 28.40% | 0.22% | 0.00% | G: 0.44% |
| Indica Intermediate | 786 | 80.90% | 17.60% | 0.00% | 0.00% | G: 1.53% |
| Temperate Japonica | 767 | 1.80% | 65.80% | 13.04% | 1.69% | G: 17.60% |
| Tropical Japonica | 504 | 1.00% | 76.40% | 0.60% | 3.77% | G: 18.25% |
| Japonica Intermediate | 241 | 1.70% | 63.50% | 4.15% | 21.58% | G: 9.13% |
| VI/Aromatic | 96 | 10.40% | 83.30% | 2.08% | 0.00% | G: 4.17% |
| Intermediate | 90 | 33.30% | 50.00% | 6.67% | 0.00% | G: 10.00% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503683293 | GA -> DEL | N | N | silent_mutation | Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0503683293 | GA -> G | LOC_Os05g07010.1 | upstream_gene_variant ; 2009.0bp to feature; MODIFIER | silent_mutation | Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0503683293 | GA -> G | LOC_Os05g07010.2 | upstream_gene_variant ; 2009.0bp to feature; MODIFIER | silent_mutation | Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0503683293 | GA -> G | LOC_Os05g07020.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0503683293 | GA -> TA | LOC_Os05g07010.1 | upstream_gene_variant ; 2008.0bp to feature; MODIFIER | silent_mutation | Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0503683293 | GA -> TA | LOC_Os05g07010.2 | upstream_gene_variant ; 2008.0bp to feature; MODIFIER | silent_mutation | Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| vg0503683293 | GA -> TA | LOC_Os05g07020.1 | intron_variant ; MODIFIER | silent_mutation | Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503683293 | NA | 2.40E-32 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503683293 | NA | 5.64E-19 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503683293 | NA | 2.59E-25 | mr1943 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503683293 | NA | 5.68E-07 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503683293 | NA | 7.83E-18 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |