\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503683293:

Variant ID: vg0503683293 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 3683293
Reference Allele: GAAlternative Allele: TA,G
Primary Allele: TASecondary Allele: GA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGACTTGCTGATCTCGCGCGTACGCGCTAATTAGCAATCTCGATCTTCACCACTGCAACGGCTCTCTTCTCCTTGCTCATCAAGGTTAAATAAAAGAAAA[GA/TA,G]
AAAAAAAAAGAAAAAAAACTTTCTTTGCCTACTGCCGCTTTTATTTCTTGCGCTCTAGCCGTCGAACATCAATTGTGCCTGATGATGTCCTCTTCATCAG

Reverse complement sequence

CTGATGAAGAGGACATCATCAGGCACAATTGATGTTCGACGGCTAGAGCGCAAGAAATAAAAGCGGCAGTAGGCAAAGAAAGTTTTTTTTCTTTTTTTTT[TC/TA,C]
TTTTCTTTTATTTAACCTTGATGAGCAAGGAGAAGAGAGCCGTTGCAGTGGTGAAGATCGAGATTGCTAATTAGCGCGTACGCGCGAGATCAGCAAGTCA

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of GA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.30% 40.10% 2.86% 1.78% G: 5.99%
All Indica  2759 81.00% 18.30% 0.11% 0.00% G: 0.62%
All Japonica  1512 1.50% 69.00% 7.47% 5.56% G: 16.47%
Aus  269 11.20% 83.30% 4.09% 0.00% G: 1.49%
Indica I  595 96.00% 3.90% 0.00% 0.00% G: 0.17%
Indica II  465 81.70% 18.10% 0.22% 0.00% NA
Indica III  913 71.00% 28.40% 0.22% 0.00% G: 0.44%
Indica Intermediate  786 80.90% 17.60% 0.00% 0.00% G: 1.53%
Temperate Japonica  767 1.80% 65.80% 13.04% 1.69% G: 17.60%
Tropical Japonica  504 1.00% 76.40% 0.60% 3.77% G: 18.25%
Japonica Intermediate  241 1.70% 63.50% 4.15% 21.58% G: 9.13%
VI/Aromatic  96 10.40% 83.30% 2.08% 0.00% G: 4.17%
Intermediate  90 33.30% 50.00% 6.67% 0.00% G: 10.00%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503683293 GA -> DEL N N silent_mutation Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0503683293 GA -> G LOC_Os05g07010.1 upstream_gene_variant ; 2009.0bp to feature; MODIFIER silent_mutation Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0503683293 GA -> G LOC_Os05g07010.2 upstream_gene_variant ; 2009.0bp to feature; MODIFIER silent_mutation Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0503683293 GA -> G LOC_Os05g07020.1 intron_variant ; MODIFIER silent_mutation Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0503683293 GA -> TA LOC_Os05g07010.1 upstream_gene_variant ; 2008.0bp to feature; MODIFIER silent_mutation Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0503683293 GA -> TA LOC_Os05g07010.2 upstream_gene_variant ; 2008.0bp to feature; MODIFIER silent_mutation Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N
vg0503683293 GA -> TA LOC_Os05g07020.1 intron_variant ; MODIFIER silent_mutation Average:60.489; most accessible tissue: Zhenshan97 flower, score: 69.775 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503683293 NA 2.40E-32 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503683293 NA 5.64E-19 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503683293 NA 2.59E-25 mr1943 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503683293 NA 5.68E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503683293 NA 7.83E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251