\
| Variant ID: vg0503608486 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3608486 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.06, others allele: 0.00, population size: 163. )
GACATTATTATCATAGCTAAACTGGCATTGATGAGTTAGTAGTTTCCATTACCAGAGTAAAAAAATGACATTCCTAATGACTAGGACTTGTTCTTTTTTT[A/T]
AAAAAAAAAGATAATAATGTCGGTTGTGCAGCTGTGTGCGACTATGGAGGAGGAGTGGGGAATGTGGGGAGCTGCGGGCTTGGTGCCAGGAGGAAGCTTG
CAAGCTTCCTCCTGGCACCAAGCCCGCAGCTCCCCACATTCCCCACTCCTCCTCCATAGTCGCACACAGCTGCACAACCGACATTATTATCTTTTTTTTT[T/A]
AAAAAAAGAACAAGTCCTAGTCATTAGGAATGTCATTTTTTTACTCTGGTAATGGAAACTACTAACTCATCAATGCCAGTTTAGCTATGATAATAATGTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.30% | 34.60% | 9.65% | 7.38% | NA |
| All Indica | 2759 | 37.70% | 34.30% | 15.55% | 12.54% | NA |
| All Japonica | 1512 | 76.30% | 22.80% | 0.99% | 0.00% | NA |
| Aus | 269 | 5.60% | 92.20% | 2.23% | 0.00% | NA |
| Indica I | 595 | 59.30% | 6.40% | 30.59% | 3.70% | NA |
| Indica II | 465 | 29.90% | 44.90% | 16.77% | 8.39% | NA |
| Indica III | 913 | 30.40% | 41.70% | 4.05% | 23.77% | NA |
| Indica Intermediate | 786 | 34.20% | 40.30% | 16.79% | 8.65% | NA |
| Temperate Japonica | 767 | 75.00% | 24.10% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 81.20% | 18.30% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 70.10% | 27.80% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 26.00% | 72.90% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 33.30% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503608486 | A -> T | LOC_Os05g06880.1 | downstream_gene_variant ; 4798.0bp to feature; MODIFIER | silent_mutation | Average:71.545; most accessible tissue: Minghui63 flag leaf, score: 85.836 | N | N | N | N |
| vg0503608486 | A -> T | LOC_Os05g06900.1 | downstream_gene_variant ; 3663.0bp to feature; MODIFIER | silent_mutation | Average:71.545; most accessible tissue: Minghui63 flag leaf, score: 85.836 | N | N | N | N |
| vg0503608486 | A -> T | LOC_Os05g06890.1 | intron_variant ; MODIFIER | silent_mutation | Average:71.545; most accessible tissue: Minghui63 flag leaf, score: 85.836 | N | N | N | N |
| vg0503608486 | A -> DEL | N | N | silent_mutation | Average:71.545; most accessible tissue: Minghui63 flag leaf, score: 85.836 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503608486 | NA | 1.36E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503608486 | NA | 3.13E-06 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503608486 | NA | 4.83E-06 | mr1117_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503608486 | NA | 1.17E-06 | mr1119_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503608486 | 2.12E-06 | 1.50E-07 | mr1120_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503608486 | NA | 5.73E-07 | mr1247_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |