\
| Variant ID: vg0503604454 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3604454 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CCTCGCTGCCCATTTGCAGGCGGCCCCCCGCACAGTACAAAATCGCCCTAGCGGAGGGCAGCAAGGGGGCCGCCTGCAAATTTCGTTGACGGCCGTCGCC[C/T]
GAGAGCGAACAGCCGTCTGCCACGTCACTTTCGCCGCCCTTTGGGATGGCGATTTTTAAGGCGACTACTTCTGTCAATTTTCAAAATGGAAAATTATTTT
AAAATAATTTTCCATTTTGAAAATTGACAGAAGTAGTCGCCTTAAAAATCGCCATCCCAAAGGGCGGCGAAAGTGACGTGGCAGACGGCTGTTCGCTCTC[G/A]
GGCGACGGCCGTCAACGAAATTTGCAGGCGGCCCCCTTGCTGCCCTCCGCTAGGGCGATTTTGTACTGTGCGGGGGGCCGCCTGCAAATGGGCAGCGAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.10% | 43.80% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 90.70% | 9.20% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 12.30% | 87.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.40% | 13.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 87.80% | 12.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 61.50% | 38.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503604454 | C -> T | LOC_Os05g06870.1 | upstream_gene_variant ; 2763.0bp to feature; MODIFIER | silent_mutation | Average:37.57; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| vg0503604454 | C -> T | LOC_Os05g06890.1 | upstream_gene_variant ; 3048.0bp to feature; MODIFIER | silent_mutation | Average:37.57; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| vg0503604454 | C -> T | LOC_Os05g06880.1 | downstream_gene_variant ; 766.0bp to feature; MODIFIER | silent_mutation | Average:37.57; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| vg0503604454 | C -> T | LOC_Os05g06880-LOC_Os05g06890 | intergenic_region ; MODIFIER | silent_mutation | Average:37.57; most accessible tissue: Minghui63 root, score: 54.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503604454 | NA | 1.22E-06 | mr1321 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503604454 | 3.44E-06 | 3.44E-06 | mr1612 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |