\
| Variant ID: vg0503490446 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3490446 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 259. )
TTTTTGCATTTTAGATATAACAAGAATTCAGAATGACTAAGCTGCCATTTGCAATCTATTGCGGCTTGAACCAAGCATTTTGAATTACTCCCAGGGCTAG[T/C]
AATGTGTTCTTTTTTTCTGTAGGGTCATATTTTACTATGTTAATCTTATCGGCTTTTTAACGTTTCACTTTTGGTTAAGCTTTTTCAGTTTTTGATGTTG
CAACATCAAAAACTGAAAAAGCTTAACCAAAAGTGAAACGTTAAAAAGCCGATAAGATTAACATAGTAAAATATGACCCTACAGAAAAAAAGAACACATT[A/G]
CTAGCCCTGGGAGTAATTCAAAATGCTTGGTTCAAGCCGCAATAGATTGCAAATGGCAGCTTAGTCATTCTGAATTCTTGTTATATCTAAAATGCAAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.90% | 7.80% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 86.40% | 13.30% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.74% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 78.30% | 21.20% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 86.00% | 13.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503490446 | T -> C | LOC_Os05g06710.1 | downstream_gene_variant ; 2170.0bp to feature; MODIFIER | silent_mutation | Average:45.206; most accessible tissue: Callus, score: 79.623 | N | N | N | N |
| vg0503490446 | T -> C | LOC_Os05g06700.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.206; most accessible tissue: Callus, score: 79.623 | N | N | N | N |
| vg0503490446 | T -> C | LOC_Os05g06700.2 | intron_variant ; MODIFIER | silent_mutation | Average:45.206; most accessible tissue: Callus, score: 79.623 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503490446 | NA | 1.57E-06 | mr1792 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503490446 | NA | 2.88E-06 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503490446 | 4.68E-06 | 1.98E-06 | mr1577_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503490446 | 5.51E-06 | 7.95E-07 | mr1577_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503490446 | NA | 5.08E-06 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503490446 | 8.48E-06 | 4.56E-07 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503490446 | NA | 2.19E-06 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503490446 | 3.23E-06 | NA | mr1803_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503490446 | 7.85E-06 | 9.35E-07 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503490446 | NA | 3.36E-06 | mr1932_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |