\
| Variant ID: vg0503485496 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3485496 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )
TTATATTTTGATAAAAAATTATAAATTAATTTTATAATATATCTAAATTATTTTTAGATTTTACTAAATTACTTCCTAGACATATAAAAGTAAATAAATT[C/T]
AATAAAGCCTAAAAGTAATTTACATATATTATAGAAGTAACTTAAACAAAAAGAAAGTAGCTTTGTCATGATATTAGAAGTAATATGTAGTAGGGATAAA
TTTATCCCTACTACATATTACTTCTAATATCATGACAAAGCTACTTTCTTTTTGTTTAAGTTACTTCTATAATATATGTAAATTACTTTTAGGCTTTATT[G/A]
AATTTATTTACTTTTATATGTCTAGGAAGTAATTTAGTAAAATCTAAAAATAATTTAGATATATTATAAAATTAATTTATAATTTTTTATCAAAATATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 10.00% | 1.02% | 0.02% | NA |
| All Indica | 2759 | 82.10% | 16.70% | 1.20% | 0.04% | NA |
| All Japonica | 1512 | 99.60% | 0.10% | 0.26% | 0.00% | NA |
| Aus | 269 | 95.20% | 0.70% | 4.09% | 0.00% | NA |
| Indica I | 595 | 96.80% | 2.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 86.70% | 11.80% | 1.29% | 0.22% | NA |
| Indica III | 913 | 73.30% | 25.50% | 1.20% | 0.00% | NA |
| Indica Intermediate | 786 | 78.40% | 20.00% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.80% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503485496 | C -> T | LOC_Os05g06700.1 | upstream_gene_variant ; 3670.0bp to feature; MODIFIER | silent_mutation | Average:35.821; most accessible tissue: Callus, score: 70.776 | N | N | N | N |
| vg0503485496 | C -> T | LOC_Os05g06700.2 | upstream_gene_variant ; 3670.0bp to feature; MODIFIER | silent_mutation | Average:35.821; most accessible tissue: Callus, score: 70.776 | N | N | N | N |
| vg0503485496 | C -> T | LOC_Os05g06690.1 | downstream_gene_variant ; 390.0bp to feature; MODIFIER | silent_mutation | Average:35.821; most accessible tissue: Callus, score: 70.776 | N | N | N | N |
| vg0503485496 | C -> T | LOC_Os05g06690.3 | downstream_gene_variant ; 3019.0bp to feature; MODIFIER | silent_mutation | Average:35.821; most accessible tissue: Callus, score: 70.776 | N | N | N | N |
| vg0503485496 | C -> T | LOC_Os05g06690.2 | downstream_gene_variant ; 390.0bp to feature; MODIFIER | silent_mutation | Average:35.821; most accessible tissue: Callus, score: 70.776 | N | N | N | N |
| vg0503485496 | C -> T | LOC_Os05g06690-LOC_Os05g06700 | intergenic_region ; MODIFIER | silent_mutation | Average:35.821; most accessible tissue: Callus, score: 70.776 | N | N | N | N |
| vg0503485496 | C -> DEL | N | N | silent_mutation | Average:35.821; most accessible tissue: Callus, score: 70.776 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503485496 | 4.70E-06 | 3.85E-07 | mr1792 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503485496 | 5.39E-06 | 2.25E-06 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503485496 | 7.20E-06 | 3.62E-06 | mr1577_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503485496 | 3.52E-06 | 4.95E-07 | mr1577_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503485496 | NA | 3.60E-06 | mr1587_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503485496 | 9.42E-06 | 8.17E-07 | mr1792_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503485496 | NA | 1.46E-06 | mr1792_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503485496 | 3.63E-06 | NA | mr1803_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503485496 | 5.87E-06 | 7.65E-07 | mr1803_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503485496 | NA | 3.96E-06 | mr1932_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |