\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503485496:

Variant ID: vg0503485496 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3485496
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTATATTTTGATAAAAAATTATAAATTAATTTTATAATATATCTAAATTATTTTTAGATTTTACTAAATTACTTCCTAGACATATAAAAGTAAATAAATT[C/T]
AATAAAGCCTAAAAGTAATTTACATATATTATAGAAGTAACTTAAACAAAAAGAAAGTAGCTTTGTCATGATATTAGAAGTAATATGTAGTAGGGATAAA

Reverse complement sequence

TTTATCCCTACTACATATTACTTCTAATATCATGACAAAGCTACTTTCTTTTTGTTTAAGTTACTTCTATAATATATGTAAATTACTTTTAGGCTTTATT[G/A]
AATTTATTTACTTTTATATGTCTAGGAAGTAATTTAGTAAAATCTAAAAATAATTTAGATATATTATAAAATTAATTTATAATTTTTTATCAAAATATAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 10.00% 1.02% 0.02% NA
All Indica  2759 82.10% 16.70% 1.20% 0.04% NA
All Japonica  1512 99.60% 0.10% 0.26% 0.00% NA
Aus  269 95.20% 0.70% 4.09% 0.00% NA
Indica I  595 96.80% 2.70% 0.50% 0.00% NA
Indica II  465 86.70% 11.80% 1.29% 0.22% NA
Indica III  913 73.30% 25.50% 1.20% 0.00% NA
Indica Intermediate  786 78.40% 20.00% 1.65% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 97.90% 0.80% 1.24% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503485496 C -> T LOC_Os05g06700.1 upstream_gene_variant ; 3670.0bp to feature; MODIFIER silent_mutation Average:35.821; most accessible tissue: Callus, score: 70.776 N N N N
vg0503485496 C -> T LOC_Os05g06700.2 upstream_gene_variant ; 3670.0bp to feature; MODIFIER silent_mutation Average:35.821; most accessible tissue: Callus, score: 70.776 N N N N
vg0503485496 C -> T LOC_Os05g06690.1 downstream_gene_variant ; 390.0bp to feature; MODIFIER silent_mutation Average:35.821; most accessible tissue: Callus, score: 70.776 N N N N
vg0503485496 C -> T LOC_Os05g06690.3 downstream_gene_variant ; 3019.0bp to feature; MODIFIER silent_mutation Average:35.821; most accessible tissue: Callus, score: 70.776 N N N N
vg0503485496 C -> T LOC_Os05g06690.2 downstream_gene_variant ; 390.0bp to feature; MODIFIER silent_mutation Average:35.821; most accessible tissue: Callus, score: 70.776 N N N N
vg0503485496 C -> T LOC_Os05g06690-LOC_Os05g06700 intergenic_region ; MODIFIER silent_mutation Average:35.821; most accessible tissue: Callus, score: 70.776 N N N N
vg0503485496 C -> DEL N N silent_mutation Average:35.821; most accessible tissue: Callus, score: 70.776 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503485496 4.70E-06 3.85E-07 mr1792 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503485496 5.39E-06 2.25E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503485496 7.20E-06 3.62E-06 mr1577_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503485496 3.52E-06 4.95E-07 mr1577_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503485496 NA 3.60E-06 mr1587_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503485496 9.42E-06 8.17E-07 mr1792_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503485496 NA 1.46E-06 mr1792_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503485496 3.63E-06 NA mr1803_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503485496 5.87E-06 7.65E-07 mr1803_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503485496 NA 3.96E-06 mr1932_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251