\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503471756:

Variant ID: vg0503471756 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3471756
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTGCTGCCGGCGGGCTGGCGCTCCTAACCTCTTGCCGGTGCAGGGACGGAGGCCTAGCGCTATTGAAAATACAGGATTAGGAGACATAATGGAGTAAAT[C/A]
TTGTGCATGGTGGAAATCTGCTGCAAATCCCCTGTTTTCTTTCCCATTTTCCTGTCTTGTATCTACGAGAGATTTGTTTGGTGAATGGTGATTTCTTCCT

Reverse complement sequence

AGGAAGAAATCACCATTCACCAAACAAATCTCTCGTAGATACAAGACAGGAAAATGGGAAAGAAAACAGGGGATTTGCAGCAGATTTCCACCATGCACAA[G/T]
ATTTACTCCATTATGTCTCCTAATCCTGTATTTTCAATAGCGCTAGGCCTCCGTCCCTGCACCGGCAAGAGGTTAGGAGCGCCAGCCCGCCGGCAGCAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.00% 2.00% 0.00% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 94.20% 5.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 95.40% 4.60% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 1.40% 0.00% 0.00% NA
Japonica Intermediate  241 80.90% 19.10% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503471756 C -> A LOC_Os05g06680.1 upstream_gene_variant ; 3001.0bp to feature; MODIFIER silent_mutation Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0503471756 C -> A LOC_Os05g06690.1 upstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0503471756 C -> A LOC_Os05g06680.2 upstream_gene_variant ; 3001.0bp to feature; MODIFIER silent_mutation Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0503471756 C -> A LOC_Os05g06690.3 upstream_gene_variant ; 549.0bp to feature; MODIFIER silent_mutation Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0503471756 C -> A LOC_Os05g06690.2 upstream_gene_variant ; 755.0bp to feature; MODIFIER silent_mutation Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N
vg0503471756 C -> A LOC_Os05g06680-LOC_Os05g06690 intergenic_region ; MODIFIER silent_mutation Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503471756 NA 2.11E-06 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503471756 NA 1.71E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503471756 NA 2.33E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503471756 NA 1.47E-07 mr1613_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503471756 NA 3.51E-06 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503471756 NA 7.90E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251