\
| Variant ID: vg0503471756 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3471756 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTTGCTGCCGGCGGGCTGGCGCTCCTAACCTCTTGCCGGTGCAGGGACGGAGGCCTAGCGCTATTGAAAATACAGGATTAGGAGACATAATGGAGTAAAT[C/A]
TTGTGCATGGTGGAAATCTGCTGCAAATCCCCTGTTTTCTTTCCCATTTTCCTGTCTTGTATCTACGAGAGATTTGTTTGGTGAATGGTGATTTCTTCCT
AGGAAGAAATCACCATTCACCAAACAAATCTCTCGTAGATACAAGACAGGAAAATGGGAAAGAAAACAGGGGATTTGCAGCAGATTTCCACCATGCACAA[G/T]
ATTTACTCCATTATGTCTCCTAATCCTGTATTTTCAATAGCGCTAGGCCTCCGTCCCTGCACCGGCAAGAGGTTAGGAGCGCCAGCCCGCCGGCAGCAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503471756 | C -> A | LOC_Os05g06680.1 | upstream_gene_variant ; 3001.0bp to feature; MODIFIER | silent_mutation | Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0503471756 | C -> A | LOC_Os05g06690.1 | upstream_gene_variant ; 549.0bp to feature; MODIFIER | silent_mutation | Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0503471756 | C -> A | LOC_Os05g06680.2 | upstream_gene_variant ; 3001.0bp to feature; MODIFIER | silent_mutation | Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0503471756 | C -> A | LOC_Os05g06690.3 | upstream_gene_variant ; 549.0bp to feature; MODIFIER | silent_mutation | Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0503471756 | C -> A | LOC_Os05g06690.2 | upstream_gene_variant ; 755.0bp to feature; MODIFIER | silent_mutation | Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| vg0503471756 | C -> A | LOC_Os05g06680-LOC_Os05g06690 | intergenic_region ; MODIFIER | silent_mutation | Average:58.111; most accessible tissue: Zhenshan97 panicle, score: 81.135 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503471756 | NA | 2.11E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503471756 | NA | 1.71E-06 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503471756 | NA | 2.33E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503471756 | NA | 1.47E-07 | mr1613_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503471756 | NA | 3.51E-06 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503471756 | NA | 7.90E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |