Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503469093:

Variant ID: vg0503469093 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3469093
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAAAGTGGGACTCACATGTCCTCCATCTCATCCCCCAACCTCTATCTTCTCTCTCCATCGGTGAGCGTGTGCAGAGAGGGACGAGGCGGGGAGGCCGG[C/T]
AAGATTGGGCCCACGATGCTGTCGTTGATAAGGTGGGCTCATGAGAGGGGAGGTGGAGGCCGAGGCGCCACTTCCTCGCGAGCTCAAGCTCTACTATCTC

Reverse complement sequence

GAGATAGTAGAGCTTGAGCTCGCGAGGAAGTGGCGCCTCGGCCTCCACCTCCCCTCTCATGAGCCCACCTTATCAACGACAGCATCGTGGGCCCAATCTT[G/A]
CCGGCCTCCCCGCCTCGTCCCTCTCTGCACACGCTCACCGATGGAGAGAGAAGATAGAGGTTGGGGGATGAGATGGAGGACATGTGAGTCCCACTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 8.50% 0.04% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 74.90% 25.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 55.70% 44.10% 0.26% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 86.70% 13.30% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503469093 C -> T LOC_Os05g06680.1 upstream_gene_variant ; 338.0bp to feature; MODIFIER silent_mutation Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0503469093 C -> T LOC_Os05g06690.1 upstream_gene_variant ; 3212.0bp to feature; MODIFIER silent_mutation Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0503469093 C -> T LOC_Os05g06680.2 upstream_gene_variant ; 338.0bp to feature; MODIFIER silent_mutation Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0503469093 C -> T LOC_Os05g06690.3 upstream_gene_variant ; 3212.0bp to feature; MODIFIER silent_mutation Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0503469093 C -> T LOC_Os05g06690.2 upstream_gene_variant ; 3418.0bp to feature; MODIFIER silent_mutation Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0503469093 C -> T LOC_Os05g06670.1 downstream_gene_variant ; 3102.0bp to feature; MODIFIER silent_mutation Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N
vg0503469093 C -> T LOC_Os05g06680-LOC_Os05g06690 intergenic_region ; MODIFIER silent_mutation Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503469093 NA 4.59E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093 NA 5.28E-12 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093 NA 9.25E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093 NA 2.64E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093 NA 3.66E-12 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093 NA 1.35E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093 NA 1.22E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093 NA 7.37E-11 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093 NA 3.05E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093 1.01E-06 NA mr1588_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093 NA 8.56E-09 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093 NA 9.29E-07 mr1671_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093 NA 1.45E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093 NA 7.00E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093 NA 2.71E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251