Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503469093:

Variant ID: vg0503469093 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3469093
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAGTGGGACTCACATGTCCTCCATCTCATCCCCCAACCTCTATCTTCTCTCTCCATCGGTGAGCGTGTGCAGAGAGGGACGAGGCGGGGAGGCCGG[C/T]
AAGATTGGGCCCACGATGCTGTCGTTGATAAGGTGGGCTCATGAGAGGGGAGGTGGAGGCCGAGGCGCCACTTCCTCGCGAGCTCAAGCTCTACTATCTC

Reverse complement sequence

GAGATAGTAGAGCTTGAGCTCGCGAGGAAGTGGCGCCTCGGCCTCCACCTCCCCTCTCATGAGCCCACCTTATCAACGACAGCATCGTGGGCCCAATCTT[G/A]
CCGGCCTCCCCGCCTCGTCCCTCTCTGCACACGCTCACCGATGGAGAGAGAAGATAGAGGTTGGGGGATGAGATGGAGGACATGTGAGTCCCACTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	8.50%	0.04%	0.00%	NA
All Indica	2759	99.40%	0.60%	0.00%	0.00%	NA
All Japonica	1512	74.90%	25.00%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	55.70%	44.10%	0.26%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	86.70%	13.30%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503469093	C -> T	LOC_Os05g06680.1	upstream_gene_variant ; 338.0bp to feature; MODIFIER	silent_mutation	Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0503469093	C -> T	LOC_Os05g06690.1	upstream_gene_variant ; 3212.0bp to feature; MODIFIER	silent_mutation	Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0503469093	C -> T	LOC_Os05g06680.2	upstream_gene_variant ; 338.0bp to feature; MODIFIER	silent_mutation	Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0503469093	C -> T	LOC_Os05g06690.3	upstream_gene_variant ; 3212.0bp to feature; MODIFIER	silent_mutation	Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0503469093	C -> T	LOC_Os05g06690.2	upstream_gene_variant ; 3418.0bp to feature; MODIFIER	silent_mutation	Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0503469093	C -> T	LOC_Os05g06670.1	downstream_gene_variant ; 3102.0bp to feature; MODIFIER	silent_mutation	Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N
vg0503469093	C -> T	LOC_Os05g06680-LOC_Os05g06690	intergenic_region ; MODIFIER	silent_mutation	Average:70.372; most accessible tissue: Zhenshan97 panicle, score: 80.486	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503469093	NA	4.59E-12	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093	NA	5.28E-12	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093	NA	9.25E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093	NA	2.64E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093	NA	3.66E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0503469093	NA	1.35E-07	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093	NA	1.22E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093	NA	7.37E-11	mr1486_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093	NA	3.05E-10	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093	1.01E-06	NA	mr1588_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093	NA	8.56E-09	mr1588_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093	NA	9.29E-07	mr1671_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093	NA	1.45E-08	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093	NA	7.00E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503469093	NA	2.71E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251