\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503403002:

Variant ID: vg0503403002 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3403002
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


GTTATGTTTTGTTATTAATTTAGATTATATCGTGTATCTACCATCTCTTATAGGTTTTCATCATCTTGCCTAGATCCTATATTTATATTTACGCTTAATG[C/A,T]
TGCATCGGTTGAGTTCGATCTATTAAGTAATATCTATAACTATAATATCTGGCTTGTTTTATGATCATCGAGAGATATAGTATCGGGGTTTCAGCCGATC

Reverse complement sequence

GATCGGCTGAAACCCCGATACTATATCTCTCGATGATCATAAAACAAGCCAGATATTATAGTTATAGATATTACTTAATAGATCGAACTCAACCGATGCA[G/T,A]
CATTAAGCGTAAATATAAATATAGGATCTAGGCAAGATGATGAAAACCTATAAGAGATGGTAGATACACGATATAATCTAAATTAATAACAAAACATAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 9.30% 13.06% 27.87% T: 0.32%
All Indica  2759 25.40% 15.70% 17.43% 40.99% T: 0.43%
All Japonica  1512 90.90% 0.10% 2.71% 6.28% NA
Aus  269 45.00% 0.40% 27.88% 25.65% T: 1.12%
Indica I  595 6.20% 1.30% 27.56% 64.87% NA
Indica II  465 21.10% 28.20% 13.55% 36.99% T: 0.22%
Indica III  913 41.50% 20.70% 12.92% 23.77% T: 1.10%
Indica Intermediate  786 23.90% 13.40% 17.30% 45.29% T: 0.13%
Temperate Japonica  767 92.40% 0.10% 2.61% 4.82% NA
Tropical Japonica  504 96.20% 0.00% 1.19% 2.58% NA
Japonica Intermediate  241 75.10% 0.00% 6.22% 18.67% NA
VI/Aromatic  96 76.00% 1.00% 11.46% 11.46% NA
Intermediate  90 75.60% 2.20% 10.00% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503403002 C -> T LOC_Os05g06580.1 upstream_gene_variant ; 2202.0bp to feature; MODIFIER silent_mutation Average:22.324; most accessible tissue: Callus, score: 44.633 N N N N
vg0503403002 C -> T LOC_Os05g06590.1 upstream_gene_variant ; 1866.0bp to feature; MODIFIER silent_mutation Average:22.324; most accessible tissue: Callus, score: 44.633 N N N N
vg0503403002 C -> T LOC_Os05g06580-LOC_Os05g06590 intergenic_region ; MODIFIER silent_mutation Average:22.324; most accessible tissue: Callus, score: 44.633 N N N N
vg0503403002 C -> DEL N N silent_mutation Average:22.324; most accessible tissue: Callus, score: 44.633 N N N N
vg0503403002 C -> A LOC_Os05g06580.1 upstream_gene_variant ; 2202.0bp to feature; MODIFIER silent_mutation Average:22.324; most accessible tissue: Callus, score: 44.633 N N N N
vg0503403002 C -> A LOC_Os05g06590.1 upstream_gene_variant ; 1866.0bp to feature; MODIFIER silent_mutation Average:22.324; most accessible tissue: Callus, score: 44.633 N N N N
vg0503403002 C -> A LOC_Os05g06580-LOC_Os05g06590 intergenic_region ; MODIFIER silent_mutation Average:22.324; most accessible tissue: Callus, score: 44.633 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503403002 9.19E-07 NA mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503403002 7.11E-07 3.38E-06 mr1577 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503403002 3.46E-06 4.63E-07 mr1792 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503403002 NA 7.91E-06 mr1792 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503403002 NA 4.24E-08 mr1425_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503403002 NA 4.66E-06 mr1456_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251