\
| Variant ID: vg0503403002 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 3403002 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 97. )
GTTATGTTTTGTTATTAATTTAGATTATATCGTGTATCTACCATCTCTTATAGGTTTTCATCATCTTGCCTAGATCCTATATTTATATTTACGCTTAATG[C/A,T]
TGCATCGGTTGAGTTCGATCTATTAAGTAATATCTATAACTATAATATCTGGCTTGTTTTATGATCATCGAGAGATATAGTATCGGGGTTTCAGCCGATC
GATCGGCTGAAACCCCGATACTATATCTCTCGATGATCATAAAACAAGCCAGATATTATAGTTATAGATATTACTTAATAGATCGAACTCAACCGATGCA[G/T,A]
CATTAAGCGTAAATATAAATATAGGATCTAGGCAAGATGATGAAAACCTATAAGAGATGGTAGATACACGATATAATCTAAATTAATAACAAAACATAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.50% | 9.30% | 13.06% | 27.87% | T: 0.32% |
| All Indica | 2759 | 25.40% | 15.70% | 17.43% | 40.99% | T: 0.43% |
| All Japonica | 1512 | 90.90% | 0.10% | 2.71% | 6.28% | NA |
| Aus | 269 | 45.00% | 0.40% | 27.88% | 25.65% | T: 1.12% |
| Indica I | 595 | 6.20% | 1.30% | 27.56% | 64.87% | NA |
| Indica II | 465 | 21.10% | 28.20% | 13.55% | 36.99% | T: 0.22% |
| Indica III | 913 | 41.50% | 20.70% | 12.92% | 23.77% | T: 1.10% |
| Indica Intermediate | 786 | 23.90% | 13.40% | 17.30% | 45.29% | T: 0.13% |
| Temperate Japonica | 767 | 92.40% | 0.10% | 2.61% | 4.82% | NA |
| Tropical Japonica | 504 | 96.20% | 0.00% | 1.19% | 2.58% | NA |
| Japonica Intermediate | 241 | 75.10% | 0.00% | 6.22% | 18.67% | NA |
| VI/Aromatic | 96 | 76.00% | 1.00% | 11.46% | 11.46% | NA |
| Intermediate | 90 | 75.60% | 2.20% | 10.00% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0503403002 | C -> T | LOC_Os05g06580.1 | upstream_gene_variant ; 2202.0bp to feature; MODIFIER | silent_mutation | Average:22.324; most accessible tissue: Callus, score: 44.633 | N | N | N | N |
| vg0503403002 | C -> T | LOC_Os05g06590.1 | upstream_gene_variant ; 1866.0bp to feature; MODIFIER | silent_mutation | Average:22.324; most accessible tissue: Callus, score: 44.633 | N | N | N | N |
| vg0503403002 | C -> T | LOC_Os05g06580-LOC_Os05g06590 | intergenic_region ; MODIFIER | silent_mutation | Average:22.324; most accessible tissue: Callus, score: 44.633 | N | N | N | N |
| vg0503403002 | C -> DEL | N | N | silent_mutation | Average:22.324; most accessible tissue: Callus, score: 44.633 | N | N | N | N |
| vg0503403002 | C -> A | LOC_Os05g06580.1 | upstream_gene_variant ; 2202.0bp to feature; MODIFIER | silent_mutation | Average:22.324; most accessible tissue: Callus, score: 44.633 | N | N | N | N |
| vg0503403002 | C -> A | LOC_Os05g06590.1 | upstream_gene_variant ; 1866.0bp to feature; MODIFIER | silent_mutation | Average:22.324; most accessible tissue: Callus, score: 44.633 | N | N | N | N |
| vg0503403002 | C -> A | LOC_Os05g06580-LOC_Os05g06590 | intergenic_region ; MODIFIER | silent_mutation | Average:22.324; most accessible tissue: Callus, score: 44.633 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0503403002 | 9.19E-07 | NA | mr1577 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503403002 | 7.11E-07 | 3.38E-06 | mr1577 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503403002 | 3.46E-06 | 4.63E-07 | mr1792 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503403002 | NA | 7.91E-06 | mr1792 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503403002 | NA | 4.24E-08 | mr1425_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0503403002 | NA | 4.66E-06 | mr1456_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |