\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503366137:

Variant ID: vg0503366137 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 3366137
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 145. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAATGTTCACCAGAGTACTGAATTTACAAAGCACTTGAAATTGATTTAGATACTATCATATCAAATCTATCCAATTGGCGCCTTTCAATGAGAAGAGA[G/A]
AGAGAGAGAGAGGAGTTTGCAATAATATGAGGAGAGGAGATAAGGATGATGACTTAAAAAAAGGGAAAATTGGAACCATGCCATTATTATTTTGCAAAAT

Reverse complement sequence

ATTTTGCAAAATAATAATGGCATGGTTCCAATTTTCCCTTTTTTTAAGTCATCATCCTTATCTCCTCTCCTCATATTATTGCAAACTCCTCTCTCTCTCT[C/T]
TCTCTTCTCATTGAAAGGCGCCAATTGGATAGATTTGATATGATAGTATCTAAATCAATTTCAAGTGCTTTGTAAATTCAGTACTCTGGTGAACATTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.10% 5.00% 10.14% 2.77% NA
All Indica  2759 77.00% 1.60% 16.78% 4.64% NA
All Japonica  1512 98.80% 0.90% 0.26% 0.00% NA
Aus  269 32.00% 64.70% 2.23% 1.12% NA
Indica I  595 97.30% 0.30% 2.02% 0.34% NA
Indica II  465 72.90% 0.90% 21.51% 4.73% NA
Indica III  913 64.70% 1.00% 26.94% 7.34% NA
Indica Intermediate  786 78.40% 3.60% 13.36% 4.71% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 97.60% 2.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 88.90% 4.40% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0503366137 G -> DEL N N silent_mutation Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046 N N N N
vg0503366137 G -> A LOC_Os05g06540.1 upstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046 N N N N
vg0503366137 G -> A LOC_Os05g06540.2 upstream_gene_variant ; 2871.0bp to feature; MODIFIER silent_mutation Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046 N N N N
vg0503366137 G -> A LOC_Os05g06530.1 downstream_gene_variant ; 1561.0bp to feature; MODIFIER silent_mutation Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046 N N N N
vg0503366137 G -> A LOC_Os05g06530.2 downstream_gene_variant ; 1561.0bp to feature; MODIFIER silent_mutation Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046 N N N N
vg0503366137 G -> A LOC_Os05g06530-LOC_Os05g06540 intergenic_region ; MODIFIER silent_mutation Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0503366137 NA 6.82E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503366137 3.68E-06 1.77E-10 mr1222 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251