Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0503366137:

Variant ID: vg0503366137 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 3366137
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 145. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAATGTTCACCAGAGTACTGAATTTACAAAGCACTTGAAATTGATTTAGATACTATCATATCAAATCTATCCAATTGGCGCCTTTCAATGAGAAGAGA[G/A]
AGAGAGAGAGAGGAGTTTGCAATAATATGAGGAGAGGAGATAAGGATGATGACTTAAAAAAAGGGAAAATTGGAACCATGCCATTATTATTTTGCAAAAT

Reverse complement sequence

ATTTTGCAAAATAATAATGGCATGGTTCCAATTTTCCCTTTTTTTAAGTCATCATCCTTATCTCCTCTCCTCATATTATTGCAAACTCCTCTCTCTCTCT[C/T]
TCTCTTCTCATTGAAAGGCGCCAATTGGATAGATTTGATATGATAGTATCTAAATCAATTTCAAGTGCTTTGTAAATTCAGTACTCTGGTGAACATTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.10%	5.00%	10.14%	2.77%	NA
All Indica	2759	77.00%	1.60%	16.78%	4.64%	NA
All Japonica	1512	98.80%	0.90%	0.26%	0.00%	NA
Aus	269	32.00%	64.70%	2.23%	1.12%	NA
Indica I	595	97.30%	0.30%	2.02%	0.34%	NA
Indica II	465	72.90%	0.90%	21.51%	4.73%	NA
Indica III	913	64.70%	1.00%	26.94%	7.34%	NA
Indica Intermediate	786	78.40%	3.60%	13.36%	4.71%	NA
Temperate Japonica	767	99.60%	0.10%	0.26%	0.00%	NA
Tropical Japonica	504	97.60%	2.40%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	0.40%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	4.40%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0503366137	G -> DEL	N	N	silent_mutation	Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N
vg0503366137	G -> A	LOC_Os05g06540.1	upstream_gene_variant ; 2871.0bp to feature; MODIFIER	silent_mutation	Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N
vg0503366137	G -> A	LOC_Os05g06540.2	upstream_gene_variant ; 2871.0bp to feature; MODIFIER	silent_mutation	Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N
vg0503366137	G -> A	LOC_Os05g06530.1	downstream_gene_variant ; 1561.0bp to feature; MODIFIER	silent_mutation	Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N
vg0503366137	G -> A	LOC_Os05g06530.2	downstream_gene_variant ; 1561.0bp to feature; MODIFIER	silent_mutation	Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N
vg0503366137	G -> A	LOC_Os05g06530-LOC_Os05g06540	intergenic_region ; MODIFIER	silent_mutation	Average:43.43; most accessible tissue: Minghui63 flower, score: 55.046	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0503366137	NA	6.82E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0503366137	3.68E-06	1.77E-10	mr1222	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251